Q: Could I have help with questions 1-5 please? I apologize if the picture is semi-blurry.
A: DNA is the nucleic acid present in the cells of eukaryotic cells.
Q: The exchange of parts between non-homologous chromosomes is called ____
A: Chromosomes are present inside the cell nucleus and made up of DNA (Deoxyribonucleic acid) molecules...
Q: 1. Observe: Now that you've learned how to use a dichotomous key, you get to practice making your ow...
A: A Dichotomous Key is a guideline for classifying and identifying organisms. It is a platform that he...
Q: Hand written solution
A: The normal human genome contains only 4 nitrogenous bases and the arrangement of these bases gives r...
Q: In the petri dish in Figure 1, the bacteria Esherichia coli (E. coli) was grown and treated with dis...
A: `E.Coli - E.Coli or Escherichia coli is a type of bacteria that normally lives in your intestines. I...
Q: Coat color in an elusive (and not necessarily real) mutated mongoose in Puerto Rico is governed by m...
A: DNA is the genetic material in most living organisms. It is the information hub of the cell that con...
Q: In cats, long hair is recessive to short hair. A true-breeding (homozygous) short-haired male is mat...
A: Sir Gregor Mendel was a priest and a teacher who did the famous hybridization experiment on garden p...
Q: Kidneys serve two critical roles in vertebrates; #1 balance the concentration of salt to water insid...
A: True
Q: Chlamydomonas should best be classified under: A) One of the Protista Kingdoms of Eukarya Domain...
A: Protista Protista are a diverse group of eukaryotic organisms, most of which are microscopic. Heter...
Q: Discuss the purpose, process, and possible risks from food irradiation.
A: Food safety is a measure concern. It mainly refers to the preparation, handling, and storage of food...
Q: Please answer fast
A: Forensic science is the application of science to those criminal and civil laws that are enforced by...
Q: 4: Fanconi syndrome is a disorder where the Proximal convoluted Tubule is impaired and does not reab...
A: Fanconi syndrome is a congenital syndrome, which is caused by insufficient reabsorption in the proxi...
Q: For the Xenites, consider what appear to be homologies and analogies. Figure out the order of evolu...
A: Since you have asked multiple questions, we will solve the first question for you. If you want any s...
Q: describe a mutation that does not alter the amino acid sequence of a protein
A: introduction A mutation is a change in a DNA sequence. Mutations can result from DNA copying mistake...
Q: Create a Quote Topics:1. Role of chlorophyll in photosynthesis; and2. Role of other pigments in phot...
A: Photosynthesis is the process by which plants convert light energy into chemical energy and prepare ...
Q: Please help me with this question within an hour will appreciate your help??
A: GFP (stands for Green Fluorescent Protein) is a protein that exhibits bright green fluorescence when...
Q: Figure out the order of evolution of each character. You have been given reason to believe that, bas...
A: Cladogram is defined as the ray diagram that help to express the phylogeny or their phylogenetic re...
Q: Cindy has a history of heart valve murmurs. She went in for surgery last year and was successfully t...
A: Answer is option c.) fluoride.
Q: Please type reply is possible thanks
A: 6. A phenotype is a trait or a characteristic that can be observed in an organism. It results from t...
Q: whuch animal has the largest gluteus maximus and has the most running endurance of all animals? a. h...
A: Skeletal muscles: Skeletal muscles are voluntary muscles and are closely associated with the skeleta...
Q: Which of the following is not a use of modern biotechnology? Select one: a. The insertion of a bac...
A: According to the question, we have to choose the option which is not a use of modern biotechnology. ...
Q: frameshift mutation‘s affect the reading frame of what molecule
A: A frameshift mutation is a kind of mutation which includes insertion or deletion of extra bases of D...
Q: Answer they last two questions
A: The central dogma is defined as the pattern by which the genetic information present in the genetic ...
Q: What is a recombinant DNA? Select one: a. During meiosis, sister chromatids cross over to produce ...
A: Recombinant DNA or rDNA technology is a powerful tool of biotechnology through which we can insert a...
Q: In terms of brain wave patterns and stages of sleep, what is the opposite of narcolepsy? Select one...
A: Narcolepsy is associated with REM sleep. REM means rapid eye movement.
Q: The "skin test" is diagnostic for tuberculosis. What is the principle behind this test? O Macrophage...
A: Tuberculosis is a very common disease that is caused due to the infection of bacteria Mycobacterium ...
Q: Based on the text on mosquitoes mating: 1. Identify abiotic factors that support the survival and r...
A: A pest is an organism that harms humans or humans' concerns. This term is specifically used in the c...
Q: Identify the term that best matches the definition or statement given. releases energy i...
A: Mitochondria : Mitochondria - Releases energy in the cell. Nucleus : Nu...
Q: Differentiate the locations of flagella by providing illustrations
A: Flagella or flagellum are microscopic hair like structure intricate in the locomotion of the cell.
Q: a b c or d
A: Giant pandas have developed unique adaptations for their cold, wet habitat and their penchant for ba...
Q: 16
A: Hardy Weinberg Principle: This principle states that both alleles and genotype frequencies in a popu...
Q: Typically owned by corporations based in MDC's, these commercial farms are located in LDC's and grow...
A: Across the world, farming is practised in many ways. Depending upon the geographical conditions, dem...
Q: Which cell in human body contain Lamellipodia(be specific),does skeleton muscle cell contain Lamelli...
A: Lamellipodia are thin sheet like filamentous structures composed of dense actin filaments and are de...
Q: Hand written solution
A: Step 1 Genetics is the science which deals with the principle and mechanism of biological inheritanc...
Q: Activity 1. Analyze the diagram below and give your honest interpretation. DNA RNA PROTEIN nucleus c...
A: Deoxyribonucleic acid or DNA is a nucleic acid that stores genetic information in most of the organi...
Q: Answer the following scenarios like you are the experts in the field of genetic engineering. Write y...
A: In heredity, gene occupies the basic physical and functional unit. They are found to be composed of ...
Q: Why would failure to transport Cl - into the lumen of the airways cause the secreted mucus to be thi...
A: Mucus plays an essential role in the regulation of body fluids. It also acts as an important part of...
Q: mutations occur in what molecule
A: The mutation is one of the significant mechanism which directly affects the survival of the organism...
Q: In humans, brown eyes (B) are dominant over blue. A brown eyed man marries a blue-eyed (b) woman and...
A:
Q: Since early 2020 human societies around the world have suffered a viral pandemic and struggled to co...
A: A pandemic is an infectious disease that has affected multiple large areas or continents. Corona vir...
Q: Compared to most drugs, nicotine is unusual, because at low doses it is mainly astimulant, but at hi...
A: Nicotine is a chemical found in tobacco as it causes a rush of adrenaline when absorbed in the blood...
Q: Sacteria Esherichi anitizer, DiskB left untreated and C. usion to the data? e growth of Streptococcu...
A: Answer: Introduction: Susceptibility means a microorganism like bacteria and fungi are incapable or ...
Q: What is another term for plaques that has formed on teeth? Biofilm O Gumma O Fungus balls Vesicles O...
A: Bacteria are minute organisms that can not be seen by our naked eye. It is responsible for numerous ...
Q: Human Uses of Fermentation Kimchi - indicate: The organisms doing the fermenting The metabolic...
A: Fermentation is a natural process of preserving food used by man for a very long time in civilized h...
Q: Which of the following is NEVER associated with elephantiasis?
A: Ans- a) Contact with elephants Elephantiasis or Filariasis disease is caused by Wuchereria (W. bancr...
Q: In humans, brown eyes (B) are dominant over blue. A brown eyed man marries a blue-eyed (b) woman and...
A: Brown eyes (B) = Dominant Blue eye (b)= Recessive
Q: Can you type response if possible please? Thanks
A: Sex is a biological trait which is determined by the presence of particular type of sex chromosome i...
Q: Formula of is used to estimate the volume of a neutrophil
A: WBC or white blood cells are the most essential part of the lymphatic system. It is also known as le...
Q: What genus is the most likely cause of white, patchy lesions on the tongue? O Streptococcus. O Asper...
A: Genus is the taxonomic rank that help in classification of organisms.
Q: what is the molecular diagnosis of infectious diseases? why molecular tests are used as diagnostic t...
A: BASIC INFORMATION DISEASE It is basically the illness of the body. This affects our bodily functions...
Give the recognition sequences for each of the restriction enzymes (a) PagI, (b) AluI, (c) PstI, and (d) RcaI. Show the sequence in double-stranded DNA (dsDNA) format, indicate the cleavage position with a ^, and mention which types of ends are generated in each case (blunt or sticky; 5’ or 3’ overhang)?
Recognition sequence for a)PagI cleaves DNA at the recognition sequence 5' ---T ^CATGA--- 3' b) AluI cleaves DNA at the recognition sequence 5' AG^CT 3' c) PstI cleaves DNA at the recog.
Trending now
This is a popular solution!
Step by step
Solved in 2 steps with 8 images
- Given what you know about the structure and functionof telomerase, provide a plausible model to explain howa species could exist with a combination of two differentrepeats (for example, TTAGGG and TTGTGG) on eachof their telomeres5'– ATGGCGAGGCGGCAGCTGTTATGGTGA – 3' In the sequence above, suppose that the 20th nucleotide of the template (an T) was mutated to a A. (A) Now, what is the mRNA sequence? (B) What is the amino acid sequence of the translated protein? (C) Would this protein be able to carry out its function?BamHI, cleaves after the first G: 5’ G GATCC 3’ 3’ CCTAG G 5’ Does cleavage by BamHI result in a 5’ or 3’ overhang? What is the sequence of this overhang?
- Show the nucleotide sequence changes that might arise in a dsDNA (coding strand segment GCTA) upon mutagenesis with (a) HNO2 (b) bromouracil and (c) 2-aminopourineBclI cleaves after the first T: 5’ T GATCA 3’ 3’ ACTAG T 5’ Does cleavage by BclI result in a 5’ or 3’ overhang? What is the sequence of this overhang?(i) Indicate by drawing where the RNA of Telomerase binds to the telomeric region. W, X, Y, and Z are the ends of the DNA and RNA strands respectively. Identify ends of DNA’s X, Y, and Z shown in Figure 1(a) & (b). (ii) (a) Telomerase -AAUCCCAAU- TTAGGGTTAGGGTTAGGGTTAGGGTTAGGGTTAGGG-W’ AАТСССААТСССААТСССАА-Х" (b) Telomeric DNA Figure 1
- Alignment of protein sequences from the HOx gene family identifies a highly conserved domain in the C-terminal part of the protein that is a domain (one acronym and one word). Although Hox genes have important roles during embryogenesis and tissue (one word) that are rich in the bases (one word each). To ensure high affinity binding to and differentiation, the different HOX proteins bind to very similar DNA (one acronym) (one word). the HOX proteins form complexes with (two words). and specific regulation of target A Moving to another question will save this response. K Question 12 of 15Correct order ib which the following enzynes would operate to fix a damaged nucleotide in a human gene. a) nuclease, DNA polymerase, RNA primase b) helicase, DNA polymerase, DNA ligase c) DNA ligase, nuclease, helicase d) nuclease, DNA polymerase, DNA ligasePlease label the following: (A) INITIATION *Complementary strand *Template Strand *RNA polymerase *Initiation Site *Termination Site *Promoter *5' and 3' end on each DNA strand Initiation (A) FRA FORÆTSIST Elongation (B) (C) restorag Termination IND PLATIN RNA (B) ELONGATION *Exiting DNA *Exiting RNA Transcript *Template Strand *Nucleotides (ATP, UTP, CTP, GTP) *Direction of transcription PHILLI 13' DIDI
- Give typing answer with explanation and conclusion to all parts Consider the following DNA mRNA sequence: 5’-ACTGATCCATGCCAGGGGTTTTCAACTAAAATGAAA-3’ a) What is the template sequence this mRNA was transcribed from? Include 5’ and 3’ labels. b) Based on this sequence, what you predict would be the resulting peptide sequence from it. c) In examining this sequence what is the proper reading frame of the open reading frame? (+1, +2, +3, -1, -2, or -3). d) What would you predict the peptide sequence to be if there was the following mutation that led to a base change: 5’-ACTGATGCATGCCAGGGGTTTTCAACTAAAATGAAA-3’Telomerase supplies its own template RNA molecule as shown in Figure 3 below: B AAUCCCAAU TTAGGGTTAGGGTTAGGGTTAGGGTTAGGGTTAGGG-W' JAATCCCAATCCCAATCCCAA-X' Figure 3 (i) Label the ends (5' and 3') on the DNA and RNA strand at position X, Y and Z, in the Figure 3. (ii) Draw and explain the two loop structures at the end of telomere.Given the partial transposons DNA sequence 5’-ACCGTATTCGGT-3’ upstream from the central region, assuming both terminal inverted repeats and flanking direct repeats have 6 base pairs, hypothetically write the transposon structure downstream from the central region.