Doctors analyze DNA sequences to screen for diseases. Proteins can be injected into cells to encode damaged DNA sequences. Scientists use DNA sequences to determine guilt in legal cases. The DNA sequence of genes is passed from parents to their offspring. The sequence of our DNA determines the shape and function of our proteins. The sequence of mitochondrial genes provides information about human evolution, disease, and
Q: 1. Write the mRNA strand that would be created based on the DNA strand below. 2. Write the tRNA…
A: Deoxyribonucleic acid or DNA is the molecule that contains the genetic material in living organisms…
Q: Color blindness in humans is an X-linked recessive trait. This means that...
A: X-linked inheritance, also known as X-linked genetic inheritance, refers to the inheritance pattern…
Q: The waste products of cellular respiration include ______. water and carbon dioxide water…
A: Respiration is a biochemical process by which an organism produces energy. Respiration is of two…
Q: What is required for PKC activation? Choose one: A. binding to Gq and DAG B. binding to Ga C.…
A: Protein kinase C (PKC) is a group of enzymes that are involved in signal transduction. They control…
Q: An infection that starts in one location but is allowed to spread through the body is called a…
A: Infection begins when the pathogens like bacteria or virus enter our body and may causes deleterious…
Q: Upon palpation of the neck you find your patient has a tender, swollen and mobile lymph node along…
A: The palpation of a tender, swollen, and mobile lymph node in the neck can provide valuable insights…
Q: Karyotyping can be used to reveal the number, size, and form of chromosomes in an actively- dividing…
A: Karyotyping is a cytogenetic technique used to study and analyze the number, size, and structure of…
Q: Which of the following stages illustrate metaphase?
A: CELL CYCLE: The sequence of events that precedes the division of a cell is known as the cell…
Q: After incubating your Spread Plates for our Viable Count Exercise, your colony counts for each of…
A: Cells that are viable or alive are counted in the viable plate count, also known as the plate…
Q: Below is a diagram showing decreased fitness before and after a hypothetical bottleneck in which all…
A: When individuals from small populations or the same or closely related genetic background mate…
Q: Which of the following statements is TRUE? The actual size of breasts has no relationship to a…
A: The unchecked and abnormal proliferation of cells within the body is the hallmark of the…
Q: https://www.khanacademy.org/science/biology/biotech-dna-technology/dna-cloning-tutorial/a/overview-d…
A: Genetic cloning techniques used in the lab and natural genetic recombination processes share some…
Q: What characteristic of the methanogens makes it logical to discuss them with the Bacteria rather…
A: Methanogens are a group of microorganisms belonging to the domain Archaea. They are unique in their…
Q: During replication of a DNA molecule, the daughter strands are not produced in exactly the same…
A: During DNA replication, both strands of the original DNA molecule serve as templates for the…
Q: Based on the trends in the data, which statement best explains the trends in the bison population…
A: In 1995, wolves were introduced into Yellowstone National Park for several reasons, chief among…
Q: Use these pictures with the tables/data to answer these questions. Answer the questions completely…
A: The phenomena described in the tables shown above is Industrial melanism which showed how the moth…
Q: Part I: Fill in the Blank: Match one term from the word bank below which best completes each…
A: All biochemical reactions that take place within living things in order to sustain life are referred…
Q: Question 12 In men, symptoms of gonorrhea and chlamydia are: O generally less obvious than in women…
A: Any sickness or condition brought on by the growth of bacteria or poisons is referred to as a…
Q: Match the following formulas with their correct descriptions form the drop down menu provided.…
A: Population dynamics is a fundamental concept in ecology and biology that involves studying the…
Q: This is the enzyme that helps join components of DNA after the initial replication. DNA Ligase…
A: A cell duplicates its DNA during the critical process of DNA replication. It entails the double…
Q: A solution with more SH-ions than H+ ions would be O basic O acidic O neutral
A: Biochemistry examines the chemistry of living things and the molecular underpinnings of the…
Q: Within the general field of biotechnology, DNA technology uses modern laboratory techniques for the…
A: DNA technology refers to modern laboratory techniques used for studying, analyzing, and manipulating…
Q: A(n) _____________________, such as the garden pea, is a non-human species that is extensively…
A: Model organisms play a critical role in biological and biomedical research. They are species that…
Q: Give typing answer with explanation and conclusion Which activity results from the action of…
A: The process of protein digestion is a complex series of events that occurs in various stages along…
Q: A disease outbreak that covers multiple nations or even the entire Earth is called O Pandemic O…
A: Let's see the explanation to understand the answer
Q: a Û ✰ 2 A patient is suspected of having a certain type of cancer that involves several genes.…
A: DNA microarray, also known as gene expression microarray or DNA chip, is a powerful tool used to…
Q: Which of the following occurs during prophase? The nuclear envelope forms. Chromosomes…
A: In eukaryotes, there are two types of cell divisions takes place which are Mitosis and Meiosis.…
Q: The diagram shows the two forms of a eukaryotic chromosome that occur during the cell cycle. For…
A: 1. The cell cycle is a series of ordered events that cells go through as they grow, replicate their…
Q: Pelvic inflammatory disease O Can be caused by undiagnosed gonorrhea or Chlamydia infections which…
A: Pelvic inflammatory disease (PID) is an infection of the upper female reproductive tract, including…
Q: Explain the concept of heredity, as well as the connections that exist between things?
A: Genetics is a branch of science which deals with the study of genes and heredity. Gene is the…
Q: 9 Which of the following statements about transcription is not true? In both prokaryotes and…
A: Transcription is the process by which genetic information encoded in a gene's DNA sequence is copied…
Q: What chromosomes belong to a normal human female? 44 autosomes and 2 X chromosomes 22…
A: In humans, the ploidy of chromosomes is typically referred to as diploid. Diploid refers to having…
Q: Pick the Correct term for the Label: A O Anticodon O Codon Ribosome O Protein Chain OmRNA O tRNA O…
A: The translation is the process in which proteins are synthesized by ribosomes. Translation occurs…
Q: How long did it take to get from early bipedals to more sophisticated bipedals like Lucy?
A: The term "Lucy" specifically refers to the fossilized remains of an Australopithecus afarensis…
Q: he ultimate source of the energy in food is ______. ATP producers the sun…
A: The energy that sustains life on Earth is derived from a variety of sources, and understanding its…
Q: The final electron acceptor of aerobic respiration is ______. lactic acid NAD+ ATP…
A: Aerobic respiration is a complex biological process that occurs in the presence of oxygen and is the…
Q: Which of the following order of events correctly depicts the Central Dogma as it would occur in an…
A: The Central Dogma of molecular biology, first proposed by Francis Crick in 1958, represents the flow…
Q: Evaluating Biotechnologies in Food Systems As we practice being able to describe choices in Biology…
A: Genetic engineering is used to enhance the crop production of food. This is necessary to meet the…
Q: What is the expected number of individuals with the genotype a*b if the genes below are not linked?…
A: In such kind of problems we should know firstly the expected number of ratio and accordingly we can…
Q: A solution of the amino acid Lysine is at pH 13. What will be the overall charge, the charge on the…
A: Amino acids are the building blocks of proteins and are composed of three functional groups: an…
Q: You will create a hand drawn, 2-dimensional, labelled diagram of the plasma membrane (not a 3D…
A: The plasma membrane is the boundary of a cell that regulated the entry and exit of different…
Q: What joins different amino acids and used peptide bonds. mRNA rRNA tRNA All of the above
A: RNA (ribonucleic acid) molecules are a type of nucleic acid found in cells that are involved in a…
Q: A biological vector is when the pathogen O None of the listed answers are correct. O Lives in the…
A: Vectors can be defined as an organisms which transmits or transfer the infectious agents from one…
Q: The figure below shows three cells from the same diploid organism. Use this figure to answer the…
A: In N-notation, the ploidy number represents the number of sets of chromosomes in a cell. For…
Q: This is an application question: Take the knowledge you learned in the course and apply it to a new…
A: Protein synthesis is the biological process through which cells generate proteins. Proteins are…
Q: Please complete the attached assignment. After reading the article that is attached, write a short…
A: Unlocking the Power of Microorganisms: Enhancing Sustainability and Progress
Q: FILL IN THE BLANK A 'wild-type' allele is the allele that is most common in a population, and that…
A: The term "allele" is used to refer to a gene's alternate form or variants. For every autosomal gene,…
Q: Type of vegetation Grasses Shrubs Trees Total species 1 32 0 0 32 Years after clear-cut logging that…
A: Succession refers to the process by which a species enters an ecosystem from a devastated or…
Q: Give typing answer with explanation and conclusion 8. The radiocarpal joint is an example of a…
A: The classification of joints in the human body is a part of the field of anatomy, more specifically,…
Step by step
Solved in 3 steps
- oslorGulolaculGACu When does DNA replication occur in the cell cycle? Replicate this strand of DNA: ATTCGC TAG GU Aanine Transcribe the same piece of DNA Stop GU Valine Cystelne Stop Use the chart to create the amino acid sequence. Arginine AC Leucine Sorine C UG Lysine Proline Define gene mutation Asparagine True or False? All mutations are harmful. Define chromosomal mutation. Histidine ThreonineC. Two mutations are known in the population, one shaded in yellow and one in blue, shown on the TEMPLATE DNA sequence below. Ursula has a mutation in the yellow- shaded underlined nucleotide: instead of an A in this position, she has a T. 5' AATCATAACTCATTG 3' What type of mutation does Ursula have? Second position First position (5 000 0 UUU UUC phe UUA UUG COU leu CỰU CUC CUA COO CUG ADO AUU AUC ile nov AUA AUG met GUU GUC GUA GUG val UCU UCC UCA ser UCA UCG COU CCU cce CCC CCA pro CCA CCG ACU www ACC ACA ACG GCU GCC GCA GCG thr ala UAU tyr UAC UAA Stop UAG Stop CAU CAC his CAC CAA gin CAG AAU AAC asn AAC AAA lys AAG GAU GAC asp glu GAA GAG UGU UGC cys UGA Stop UGG trp CGU Missense Silent Nonsense Frameshift CGC CGA arg CGA CGG AGU AGC AGA AGG GGU GGC GGA GGG Initiation Termination ser arg gly DUAG DUMU DUAU DUAG Third position (3-end)Answer whether the following statement is True or False. In our cells, protein synthesis is unidirectional and occurs from N to C terminus. True False
- Select the examples of mutation. A gene is copied twice during DNA replication. Several base pairs are skipped during DNA synthesis. A single DNA base pair is replaced with a different base pair. An incorrect amino acid is added during protein synthesis. O An incorrect base is added to an RNA sequence. ? P ook AirM. where specific parts of the DNA is changed into 2. A gene codes for I J. complementary base pairs on DNA molecules. K. an RNA molecule. L. sequences of polypeptides on DNA molecules. M. an amino acid molecule. 3. The cells of a single organism are J. all genetically identical in all the parts of the body.Name: Date: 2. The sequence of a fragment of one strand of DNA is AATTGCATATACGGGAAATACGACCGG. Transcribe this s sequence into MRNA. er bns eldst eboo oi ebitqeqylog erlt to noihiog eri qu elsm bluow tsri abios onime Jlaw as ye s 1ot noitem atelomet AHG 3. The following MRNA ştrand is being used to asemble a polyp
- When DNA copies itself..the first step that DNA must do is: DNA Polymerase checks for errors after the two strands are complete O Two new strands are made O RNA primers bring new bases to connect O The two strands of the parent DNA molecule are unzipped and split into twoDirection: Study the given amino acid sequence and DNA sequence of the Amino Acid Sequence: LEU-ISC-PRO-PRO-PHE-ILE-LEU-LEU-SER-HIS-LEU-LEU-SER What's More Activity 3.1 Check and Relate listed organisms. Cat DNA Sequence: TTAATCCCCCCGTTTATCCTACTTTCCCATCTACTAAGT Am no Acid Sequence: LEU-ISC-PRO-PRO-PHE-ILE-LEU-EU-SER-ARG-LEU-LEU.AD DNA Sequence: CTTATCCCCCCGTTTATCCTACTTTCCCGTCTACTTCGT Shark Amino Acid Sequence: LEU-ISC-PRO-PRO-PHE-ILE-LEU-LEU-SER-HIS-VAL-VAL-SER DNA Sequence: CTAATCCCCCCGTTTATCCTACTTTCCCATGTAGTAAGT Colphin Amino Acid Sequence: LEU-ISO-PRO-PRO-PHE-LE-LEU-LEU-SER-ARG-LEU-LEU-ARG DNA Sequence: CTAATCCCCCCGTTTATCCTACTTTCCCGTCTACTTCGT Lizard Amino Add Sequence: ISO-4SO ASP-GLN-PHE-ILE-LEU-HIS-SER-ARG-LEU-LEU-ARG DNA Sequence: ATTATCGACCAGTTTATCCTACATTCCCGTCTACTTCGT Sponge Activity Questions: 1. Which organisms are closely related to each other? How are they related? 2. What does this tell us about the organisms and their ancestors? 3. How amino acid sequences and DNA…Please fill in missing DNA/RNA/Amino Acid sequences.
- Explain why errors in DNA Replication are rare events in cells? should be an original thought, not Google’s. dont use others answers few sentencesāiglho ālimill JS - aliwi s DNA is made up of subunits called and each nucleotide contains and السابق 1 سؤال تمت الإجابة عليه و أسئلة O Grade 11 Biology...docxon 94 Which of the following statements is true about DNA? et red Select one: d out of O a. DNA transmit the genetic information thus, DNA must be replicated after each cell division directly question O b. Nucleic acid is another term used to describe DNA only that function to store information O c. The two strands of DNA are antiparallel, and the backbone of DNA is connected through phosphodiester bond in 3' to 5' direction d. DNA directs its own replication, programmed for RNA transcription and involved directly in protein synthesis. O e. Consist of two stands of polynucleotides and the sugar of its nucleotides made from a pentose sugar that lack Oxygen in carbon #2