Here is a list of knockout gene mutations that are desired to make in E. coli genome. You should take some time to identify what these genes are and what pathways they are either involved in and / or regulate. Gene lacZ fliE rpoA nagC ompA lexA Size of gene (bp) Protein 3075 315 990 1221 1041 609 Pathway
Q: An order was received for 3000 mg of powder medication to be reconstituted with 15 mL for use. The…
A: The conversion of medicine from its powdered state to a liquid form for administration is a crucial…
Q: What are the reactions that result in the fixation of carbon dioxide?
A: Fixation of carbon dioxide It refers to the process through which carbon dioxide is transformed…
Q: Do anthropologist considered gender as continuum?
A: When the idea of a gender continuum first came into existence, it provided a more sophisticated…
Q: Regarding Gram staining, what will be the appearance of the Gram-negative bacteria if... All steps…
A: There are several methods to differentiate bacteria into different groups, the staining method is…
Q: are you sure? i got a different answer
A: Skeletal muscles are striped and voluantary muscles. On the other hand, cardiac muscles are the…
Q: Aerobic respiration differs from anaerobic respiration in which aspect? The presence of oxygen as…
A: Respiration is the biochemical process through which living organisms, such as plants and animals,…
Q: Multicellularity has evolved multiple times in different lineages on Earth. What is one major…
A: Multicellular organisms contain more than one cell. It is more complex in structure and advanced…
Q: New traits appear in most or all individuals in a population at the same time." Please explain…
A: Trait emergence refers to the development or appearance of new characteristics or features in…
Q: list the box warnings associated with ketoconazole.
A: Ketoconazole is an antifungal medication used to treat a range of fungal infections. Although…
Q: According to the web article 'This Is Probably The First Mammal...!' scientists believe that if…
A: Climate change refers to a long-term changes in the average conditions such as temperature,…
Q: Answer with true or false for each statement: A. The Anthropocene is proposed to represent the…
A: The Anthropocene is a proposed geological epoch that represents the current era in which human…
Q: (a) Describe how to do the ruler-drop test.
A: This situation involves a scientific investigation of how caffeine affects human reaction time. The…
Q: Describe how PCR works.
A: PCR, or Polymerase Chain Reaction, is a laboratory technique used to amplify specific segments of…
Q: Describe the function of the retina
A: The retina is a layer of tissue at the back of the eye that is responsible for converting light into…
Q: Write a paragraph introduction for salmonella isolation
A: Salmonella, a genus of rod-shaped, Gram-negative bacteria, is responsible for inducing various…
Q: Movement and Population Genetics: Metapopulation models focus on the BIDE (birth, immigration,…
A: The questions that follow delve into the complicated dynamics of metapopulations, hereditary…
Q: (7) The following has receptors for the substance on their plasma membranes to produce signals for…
A: Cell signaling, also known as cellular signaling, is the process by which cells communicate with…
Q: Making cDNA from mRNA requires an enzyme called ____________________
A: Complementary DNA (cDNA) is created in molecular biology using an RNA template in a process that is…
Q: Which of the following is an example of a nosocomial disease? acquiring Giardia while drinking from…
A: Nosocomial diseases, also known as healthcare-associated infections (HAIs), refer to infections that…
Q: Aldosterone affects sodium balance by impacting sodium reabsorption in the distal nephron. If MAP…
A: The renin-angiotensin-aldosterone system (RAAS) is an intricate physiological system in the body…
Q: Purple loosestrife (Lythrum salicaria) and musk thistle (Carduus nutans) are ruderal plants that are…
A: On the basis of growth rate there are two kinds of curves obtained - one is the growth curve…
Q: Which proteins involved in the activation of T cells have the capacity for transduction without the…
A: For the activation of T-cell, there are three types of proteins which come into play:- MHC proteins…
Q: List three adaptive traits that help explain why a flowering cactus is common in the desert, but…
A: Adaptation refers to the process by which an organism undergoes changes in its structure,…
Q: Which of the following organisms would be most likely to fossilize? a. a common worm b. a…
A: Fossilization is the process by which organic remains or traces of organisms are preserved in the…
Q: match the 5 on the left with one of the answers from drop down menu
A: Amniotes are a group of animals characterized by an egg equipped with an amnion. This amnion is an…
Q: Arrange the following steps in fatty acids degradation in the correct order : A. beta-oxidation of…
A: The correct order for fatty acid degradation is: D. Fatty acid carried by albumin B. Fatty acid…
Q: Flowering plants have common ancestors with other plants and plant-like organisms. The table below…
A: Flowering plants, also known as angiosperms, are a diverse group of plants characterized by their…
Q: When Sperry and colleagues ablated the dorsal RGCs, the remaining ventral RGCs projected to the…
A: The expression patterns of Ephs and ephrins suggest that they may be involved in the mechanism used…
Q: State the conditions (temperature and pressure) above which chloroform exists as a supercritical…
A: Chloroform is a colorless, heavy, and non-flammable liquid with a sweet odor. Its chemical formula…
Q: ocular sonography in animals: 1. How should the patient be prepared?
A: When preparing an animal for ocular sonography, it is important to follow certain steps to ensure a…
Q: Which is TRUE about isovolumetric contraction of the heart? a. AV valves are closed; SL valves are…
A: Isovolumetric contraction, or the second phase of the cardiac cycle, is an event that occurs in the…
Q: In Aardvarks, straight hair (S) is dominant to curly hair (s). Two heterozygous Aardvarks (male and…
A: Straight hair (S) predominates over curly hair (s) in aardvarks. Male and female heterozygous…
Q: According to the web article 'Emperor Penguins could march to extinction... scientists studied a…
A: Here we will examine where scientists have researched populations of these penguins and the…
Q: The plant wall allows for plant cells to swell under large internal pressure, what membrane lined…
A: Plasmodesmata are membrane-lined channels that traverse the cell walls of plant cells, creating…
Q: Define the following terms: divergent evolution, convergent evolution, analogous structures,…
A: According to the concept of evolution, the cause of variability between members of a taxon must be…
Q: Based on the molecular data, which species is most closely related to humans? A) lemur catta (lemur)…
A: Sequence analysis refers to the computational analysis of DNA, RNA and peptide by comparing their…
Q: Which of the following is a condition that arises from the inappropriate formation of antibodies…
A: The inappropriate formation of antibodies that react with normal antigens of the glomeruli can lead…
Q: What steps could you take to be more environmentally friendly? List at least 5 things you could do…
A: Environment refers to the external surroundings, conditions, and factors that exist outside of an…
Q: And which of the following factors stimulate these cells to release renin? Select all that apply.…
A: The renin-angiotensin-aldosterone system (RAAS) is a complex hormonal system that plays an important…
Q: More Text Above combined with rising sea levels increased the presence of salt water in freshwater…
A: A cypress swamp is a type of wetland ecosystem characterized by the presence of bald cypress trees…
Q: R Identify the cellular morphology for this Gram stain. What is the Gram reaction? What is the…
A: The gram staining process is staining technique that is used to classify bacteria into two large…
Q: Be able to describe cyclic slow waves in terms of timing and their strength.
A: Cyclic slow waves refer to rhythmic patterns of electrical activity that occur in biological…
Q: Several DNA coding for different proteins, CRISPR, or siRNAs against different genes were expressed…
A: The given experimental setup involves the expression of various proteins and treatments using siRNAs…
Q: After the metabolism of lactose you find that the Delta G for reaction is - 30 KJ/mol. Which of the…
A: The thermodynamic variable known as the Gibbs free energy change, abbreviated as G (delta G),…
Q: According to the web article 'Evolution in real time', Dr. Richard Lenski has raised about…
A: Evolution is the process where genetic variations are accumulated in a population over a period of…
Q: In the image below, six diploid individuals are analyzed with regard to three different alleles (A,…
A: Electrophoresis is a laboratory technique used to separate and analyze molecules, such as DNA, RNA,…
Q: Which of the following statements best describes the axonal projection patterns of upper motoneurons…
A: The primary motor cortex plays a critical role in initiating and controlling voluntary muscle…
Q: Bayesian updating can be a useful tool for thinking about the development of behavior. Imagine the…
A: The Bayesian view is a way of modeling how individuals update their beliefs based on new information…
Q: am confused on how to read rarefaction curves can you explain to me how I understan the species and…
A: A rarefaction curve is a graph that shows how many different species are found in a particular area…
Q: Why do you think the Platinum TE pitches are over-seeded with another grass species (in this case,…
A: Platinum TE (Paspalum vaginatum 'Platinum TE') is a specific variety of turfgrass that is known for…
Please help fill in the table
Step by step
Solved in 3 steps
- The pre-mRNA transcript and protein made by several mutant genes were examined. The results are given below. Determine where in the gene a likely mutation lies: the promoter region, exon, intron, cap on mRNA, or ribosome binding site. a. normal-length transcript, normal-length nonfunctional protein b. normal-length transcript, no protein made c. normal-length transcript, normal-length mRNA, short nonfunctional protein d. normal-length transcript, longer mRNA, shorter nonfunctional protein e. transcript never madeThe following is a portion of a protein: met-trp-tyr-arg-gly-pro-thr-Various mutant forms of this protein have been recovered. Using the normal and mutant sequences, determine the DNA and mRNA sequences that code for this portion of the protein, and explain each of the mutations. a. met-trp- b. met-cys-ile-val-val-leu-gln- c. met-trp-tyr-arg-ser-pro-thr- d. met-trp-tyr-arg-gly-ala-val-ile-ser-pro-thr-O The lac operon in E.coli encodes enzymes necessary for the breakdown of lactose. For each enzyme (lac Z and lac Y), indicate with a + or-whether or not it is made when there is no lactose or when there is lactose. B-galactosidase (lac Z) No Lactose Permease (lac Y) Lactose Lactose No Lactose Genotype PP0 Z Y/I P*O*Z•Y* I'POCZ Y*/I P* O©Z*Y° P O Z'Y/I P'OʻZ'Y* PP O ZY*/IP*O*Z*Y* IP OCZ Y /I P*O*Z•Y* IPO ZY*/I* P*O©Z*Y• I'PO*Z Y*/IP'O*Z*Y°
- 1. You are investigating a protein that has the amino acid sequence N ... Ala – Thr - Asn – Trp – Lys - Arg - Gly – Phe – Thr ... C within its primary structure. You found that several of the mutations affecting this protein produced shortened protein molecules that terminated within this region. In one of the mutants, the Asn became the terminal (last) amino acid. (a) What DNA single-base changes(s) would cause the protein to terminate at the Asn residue? (b) What other potential sites do you see in the DNA sequence encoding this protein where mutation of a single base pair would cause premature termination of translation? >Help me figure out how I should interpret and read these graphs. We are looking to see whether the m6a acceptor mutant will have an impact on splicing. Just need a detail breakdown thanks. I am presenting at journal club and need help interpreting will the goals in mind. We are currently conducting experiments to understand how the splicing of circE7 relates to the splicing of linear E6*I. Goal is to determine whether the mutation impact splicing. Trying to understand whether m6A will impact splicing. Sm should impact splicing ratio. My PI stated that the results show that it inhibited linear splicing and promoted backsplicing. I need a detailed explanation for the entirety so I can understandThe most common MCAD mutation is shown below. The coding strand is shown for both the WT and mutant. The TATA box and kozak sequences are in parenthesis. What type of mutation is present? Wild-type:5’-ATGGCC[TATAT]ATGTCACTTGACTACGCAGCC[GCCACCATGG]ATATAGATAATGCGCGCATAGCATACTGAGGGTAGTAG-3’ Mutant:5’-ATGGCC[TATAT]ATGTCACTTGACTACGCAGCC[GCCACCATGG]ATATAGATAATGCGCGC AGAGCATACTGAGGGTAGTAG-3’ Answer: Is this a transition mutation? because there is an exchange of G instead of A? It kind of confuses me a little. help
- e B 1_30*_SP23 - General Biology I (for majors)/11364 of € 2 A us page X F1 What conditions would we find on the gene of a prokaryote if there is low amounts of tryptophan within the cytoplasm? Select one: a. lactose would attach to the repressor removing it from the promoter promoting the transcription of lactase b. no repressor is on the promoter creating constant transcription of lactase c. tryptophan would attach to the repressor removing it from the promoter promoting the transcription of lactase O d. repressors would bind to the promoter stopping the transcription of lactase e. lactose would attach to the repressor removing it from the promoter promoting the transcription of tryptophan producing enzymes no repressor is on the promoter creating constant transcription of tryptophan producing enzymes tryptophan would attach to the repressor binding it to the promoter and stopping the transcription of tryptophan producing enzymes O f. O g. 2 Oh. tryptophan would attach to the…Sickle cell hemoglobin DNA CACGTAGACTGAGG ACAC.. Sickle cell hemoglobin MRNA Sickle cell hemoglobin AA sequence 4. What type of mutation is this? Please explain why.G-LO37 Identify the consequences of mutations in different regions of a gene. The image below represents two strands of DNA: the top one corresponds to a healthy individual, and the bottom one of a sibling potentially affected with a disease due to genetic mutations Mutation 1 A + с AUA ACA AUG Met ACG GUU GUC GUA GUG Val GCU GCC GCA GCG It will result in mRNA produced Mutation 2 It will result in no mRNA produced 500 AGG The protein produced will be normal 500 + GGG Ala The Select all that applies about Mutation 1 (position -6): AAGLys AGA Arg GGU GGC GGA GGG GAC Asp GAA Glu GAGJ Gly The protein produced will have a different amino acid 1235 ATT 1235 TTT 070 2070 ALL The mutation occurs in the promoter region, and this means that the mRNA cannot be produced 1535 The mRNA and protein will both be normal because the mutation occurs outside of the consensus region of the promoter G 1535 с Affected
- The method of Northern blotting is used to determine the amountand size of a particular RNA transcribed in a given cell type.Alternative splicing (discussed in Chapter 14) produces mRNAsof different lengths from the same gene. The Northern blot shownhere was obtained using a DNA probe that is complementary tothe mRNA encoded by a particular gene. The mRNA in lanes 1through 4 was isolated from different cell types, and equal amountsof total cellular mRNA were added to each lane. Explain these results.Consider the following simple regulatory pathways. Assume the full pathway is shown. A- E- B- F- C- G- D- 1 H- A You identify several null mutations (a complete deletion of the gene). For each mutant (ind with a - sign), determine whether the final product (I, J, K or L) is inducible, uninducible, or constitutive. 2 B 3 C 4 D inducible inducible constitutive uninducible constitutive inducible inducible E uninducible F G H > > >Below is the double stranded DNA sequence of part of a hypothetical yeast genome encoding a very small gene. Transcription starts at nucleotide immediately following the promoter. The termination sequence is TATCTC. How many amino acids will this protein have? 5' TCATGAGATA GCCATGCACTA AGGCATCTGA GTTTATATCT CA 3' 3' AGTACTCTAT CGGTACGTGAT TCCGTAGACT CAAATATAGA GT 5'