Here is the complete mRNA sequence from a bacterial cell: 5' ACUAGCAGGAGACGUAAGCGAUGUGCCAGAUGCGCAGUCACACAUAACUGCAAG 3' How many tRNAs will bind to the ribosome to make the protein? 8 10. 6 4
Q: Please anser the last one
A: The adhesin intimin produced by enteropathogenic E. coli (EPEC) is known to cause a characteristic…
Q: The success of HAART (highly active antiretrovial therapy) against HIV is based on the idea that the…
A: Step 1: Understand the ProblemTo determine the effectiveness of the treatment regimen against Virus…
Q: Drag and drop from the available list of terms. Anabolic reactions are type of reaction. In these…
A: The building of complex molecules, such as sugars, from simpler ones is an anabolic process and is…
Q: According to chemist John Dalton, if one mole of nitrogen is combined with three moles of hydrogen…
A: The objective of the question is to calculate the molecular mass of ammonia (NH3), which is formed…
Q: A ALEKS - Julianna Graham - Lex ← -> C +…
A: The complete mutated DNA sequences for both types of mutations (silent and non-silent) from the…
Q: What are 2 unique cell biolgical features of the egg and 2 unique cell biological features of sperm?…
A: Key references:Giojalas, L. C., & Guidobaldi, H. A. (2020). Getting to and away from the egg, an…
Q: The pure “fire air” consumed by a burning candle in a sealed glass jar, or by a mouse during aerobic…
A: The objective of the question is to identify the element(s) present in the 'fire air' consumed by a…
Q: Question 22 STRs are useful for DNA profiling because they O are easily connected to human phenotype…
A: Answer well explained above.
Q: In case of failure of the innate immunity to contain the infection, the body will oppose a more…
A: Approach to solving the question:To address the question about cellular and humoral immunities, it's…
Q: Post-anal tail is a unique feature shared by invertabrates and jawless fish chordates tetrapods all…
A: The objective of the question is to identify the group of organisms that share the unique feature of…
Q: Question 14 Why are long reads the preferred method to sequence repetitive elements? Select the…
A: "If a repetitive region is longer than 300 basepairs (the length of a short read), it's impossible…
Q: Please complete concept map for this activity. Concept Mapping activity, you will revise your…
A: Approach to solving the question: Detailed explanation:This concept map explores the interconnected…
Q: Meiosis:
A: MEIOSISBEFORE MEIOSISInterphaseDNA is replicatedMEIOSIS IProphase ISynapses occurs; crossing over…
Q: Urgently needed
A: The correct answer to the question regarding the technical advancement that allowed the products of…
Q: I need help woth this question please
A: Step 1: Do some research about atlantic coast and pacific coast. Step 2: Get the most important…
Q: Match the following terms with the best description. Question 7 options: The…
A: The objective of the question is to match the given terms with their appropriate descriptions.
Q: Can you please check if these answers are correct, if not please correct them.
A: Aerobic respiration is the process where glucose is completely oxidized in the presence of oxygen.…
Q: You are designing a phage therapy for a cystic fibrosis patient with an multi-antibiotic resistant…
A: Option 3 advises utilizing a well-studied phage, such as T4 bacteriophage, that typically targets E.…
Q: please help me answer these questions. thank you! 1A.) How has our society's view of sexuality…
A: I hope these suggestions and recommendations help you with your assigned tasks. Have a great day…
Q: 1. The English naturalist John Ray thought that an individual dog should be classified as a member…
A: The objective of the question is to understand the primary reason why the English naturalist John…
Q: both parants are doominat tall name 4 possible offspring?
A: The question is asking for the possible offspring of two parents who are both dominant tall. In…
Q: True or false: Adaptive radiation can itself set conditions for mass extinction
A: The question is asking whether adaptive radiation, a process in which organisms diversify rapidly…
Q: having extra digits is a dominant trait. a man has extra digits while his wife and their daughter…
A: 1. **Genotypes of the Parents**: - The man has extra digits, so he must have at least one dominant…
Q: Past paper
A: The most obvious symptoms of PD include. Tremors:- Involuntary shaking of limbs, commonly starting…
Q: In the first step of your phage therapy design process, you isolate the exact Mycobacterium strain…
A: The isolation and identification of bacteria causing infection are prerequisites for the success of…
Q: STRs normally consist of repeating sequences of: Question 46 options: 13-17 bases.…
A: Short Tandem Repeats (STRs) are a type of molecular marker used in genetics. They are short…
Q: You have 3 populations inhabiting the same landmass. Individuals from the first and second…
A: The first population cannot mate with the second population, indicating reproductive isolation…
Q: You are studying a protein-protein interaction in 2 proteins. You decide to test both these proteins…
A: Approach to solving the question:Disulfide bonds unlikely:Disulfide bonds are probably broken by the…
Q: For the following diseases with their potential pedigree, mode of inheritance and the responsible…
A: Detailed explanation: Let's analyze Pedigree C, which is an X-linked recessive pedigree related to…
Q: What is the relationship between selenium and other nutrients?
A: The objective of this question is to understand the relationship between selenium, an essential…
Q: The rate of plant growth on an island near Isle Royale is such that the carrying capacity of moose…
A: 1. Initial conditions: Initially, there are 450 moose on the island, and the environment is stable…
Q: What are the characteristics/features of mousterian industry tools. What do these tools tell us…
A: The Mousterian industry is a style of predominantly flint tools associated primarily with the…
Q: Regarding optic ataxia, what is its clinical etiology, symptoms, and treatments. What are the…
A: Etiology (Causes)Brain Regions Involved:• Parietal Lobe: This region integrates visual and motor…
Q: You have 3 populations inhabiting the same landmass. Individuals from the first and second…
A: The biological species concept defines a species as a group of interbreeding individuals that are…
Q: What are IPS cells? Give an application?
A: Induced Pluripotent Stem (IPS) cells are a type of pluripotent stem cell that can be generated…
Q: There is only one correct way to perform antibody identification Question 4 options:…
A: The objective of the question is to determine whether there is only one correct method to perform…
Q: This morphologic abnormality of mature granulocytes is most frequently associated with infectious…
A: The question is asking to identify the morphologic abnormality of mature granulocytes that is most…
Q: Order the steps required to sequence a region of DNA using dideoxy sequencing. Amplify the region of…
A: Step 1: The order of the steps required to sequence a region of DNA using dideoxy sequencing…
Q: If provided with a DNA sequence, you should be able to identify where transcription will start;…
A: Answer well explained above.
Q: The KM of a Michaelis-Menten enzyme for a substrate is 1.0 x 104 M. At a substrate concentration of…
A: To solve this problem, we will be using the Michaelis-Menten equation: V=Km+[S]Vmax[S]Now let's…
Q: Below is a life table for a hypothetical organism. What is the expected lifetime reproductive…
A: 1) The answer is 2.64.To calculate the expected lifetime reproductive success for individuals…
Q: Why do birds fly?
A: 1. "Foraging": Birds have developed the ability to hunt from above, which enables them to harvest…
Q: how do the california red legged frog and the northern pacific tree frog coexist
A: The question is asking about the coexistence of two different species of frogs, the California…
Q: Based on the available evidence, which is NOT true about the australopiths: A) had small,…
A: Approach to solving the question:To approach the question systematically and accurately, follow…
Q: What is the Allele Frequency for G5 when the initial Allele Frequency for p is 0.30 and the initial…
A: Step 1: Understand Hardy-Weinberg EquilibriumThe Hardy-Weinberg equilibrium equation describes the…
Q: What is the legal basis for lawsuits filed as a result of a transfusion? Question 5 options:…
A: The objective of the question is to identify the legal basis for lawsuits that are filed as a result…
Q: Complete this sentence: The number of your genetic ancestors is [Select] lower than the same as…
A: Detailed explanation: The number of your genetic ancestors is LOWER THAN the number of your actual…
Q: Please answer the following question
A: Hope it help answer your questions. Let me know if you have any clarification. Thank you.
Q: Liability for negligence includes all of the following except: Question 4 options:…
A: The question is asking us to identify which of the provided options is not a component of liability…
Q: I need help making changes to this essay using these research articles: Wood, H. L., Spicer, J. I.,…
A: The objective of the question is to revise the given essay using the information from the provided…
Step by step
Solved in 2 steps
- For the messenger RNA sequence below, find the beginning of the amino acid coding sequence and translate the sequence using the genetic code provided below. 5' - AAUUAUGGGCAAUAUGCCGGGCcGGUUAAGCG - 3' Second Letter A UGU cys u UGC Phe UCU UU U UUC UUA UAU Tyr Ser UAC UAA UAG Leu UCA Stop UGA Stop UUG UCG Stop UGG Trp CUU CU CAU His CGU c cuc Leu ccc ССА CCG Pro CÁC CAA CAG CGC CGA CGG Arg CUA CUG Gin 1st 3rd letter Ser u letter AUU ACU AAU AAC AAA AAG Asn A AUC AUA AUG lle ACC ACA AGU AGC AGA AGG Thr Lys Arg Met ACG GUU G GUC GUA GUG GCU GAU GAC GAA Asp GGU Val GCC Ala GGC Gly GCA GGA Glu GCG GAG GGG GUsing the genetic code table provided below, identify the open reading frame in this mRNA sequence, and write out the encoded 9 amino acid long peptide sequence: 5'- CGACAUGCCUAAAAUCAUGCCAUGGAGGGGGUAACCUUUU C A G U UUU Phe UCU Ser UUC Phe UCC Ser UAC UCA Ser UAA UCG Ser UAG UUA Leu Leu G C CUU Leu CUC Leu CCC CUA Leu CUG Leu AUU lle AUC lle AUA lle AUG Met ACG ACU Thr ACC Thr ACA Thr Thr A UAU Tyr UGU Cys Tyr UGC Cys CCU Pro CAU His CGU Arg Pro CAC His Pro CAA Gln CGC Arg CGA Arg CCA CCG Pro CAG Gln CGG Arg GUU Val GCU Ala GAU GUC Val GCC Ala GAC GUA Val GCA Ala GAA GUG Val GCG Ala GAG Stop UGA Stop UGG AAU Asn AAC AAA AAG AGU Asn AGC G Lys Lys Asp Asp Glu Glu Stop A Trp Ser Ser AGA Arg AGG Arg GGU Gly GGC Gly UCAG GGA Gly GGG Gly с U C A G U C A G U C A GAssume the following portion of an mRNA. Find a start signal, and write the amino acid sequence that is coded for. 5'-GCCAUGUUUCCGAGUUAUCCCAAAGAUAAAAAAGAG 3'
- Consider the following coding 71 nucleotide DNA template sequence (It does not contain a translational start): 5’- GTTTCCCCTATGCTTCATCACGAGGGCACTGACATGTGTAAACGAAATTCCAACCTGAGCGGCGT GTTGAG-3’ By in vitro translating the mRNA, you determined that the translated peptide is 15 amino acids long. What is the expected peptide sequence in single letter abbreviations?Indicate the amino acid sequence of the protein encoded by the following mRNA molecule. Use the genetic code table and assume that the very first “AUG” the ribosome encounters will serve as the start codon and specify methionine. 5’-AAUUCAUGCCCAAAUUUGGGGCACGAAGCUUCUUAGGCUAGUCCUAAAAAA-3’What will be the overall anti-codon sequence in tRNA for this mRNA? 5’-GUAGCCUUAUCUAGCGAUCACCGUCCGUAUUACUAGUGGCCAGACUCUUUUCACCAUGUAUAGUUG-3’
- Using the Genetic Code Table in Figure 1.3, what is the proper sequence of amino acids in the polypeptide chain based from the given codons of MRNA (3' AAU GCC AGU GGU 5')? * U UUU Phe UCU) UC UCA UCG UAU] UAC Tyr UAA Stop UGA Stop A UAG Stop UGG Trp G UGU U UUC) UGC Cys Ser UUA Leu UUGJ CU) CCU CAU1 CGU His CUC CAC CAA CGC CC Leu CCA Pro Arg CUA CGA A Gin CUG) CG CAG CGG G AUU) ACU) AGU AAU1 Asn AAC, Thr AAA1 U AGC }Ser č A G AUC lle ACC A AUA J ACA AGA AUG Met ACG, AAG}Lys AGG Arg GGU GUU) GUC Val GCU) GCC GCA GCG J GAU1 Asp GACI Ala GGC GGA GGG ) G GUA Gly GAA1 GAG) A Glu GUG) G Figure 1.3 Alanine, Serine, Glycine, Asparagine Serine, Glycine, Asparagine, Alanine Glycine, Asparagine, Alanine, Serine Asparagine, Alanine, Serine, GlycineConsider the following mature mRNA from a human cell: 5' UAAUGUCGCAAUAACC 3¹ What is the sequence of amino acids in the translated protein? Second letter A First letter С U d A G บบบ UUC P U UUA UUG Leu CUU CUC CUA CUG GUU GUC GUA GUG -Phe Met-Ser-Gln Met-Arg-Lys-Ser Leu Stop-Cys-Arg-Asn-Asn C AUU AUC lle AUA ACA AUG Met ACG Val UCU UCC UCA UCG CCU CCC CCA CCG ACU ACC GCU GCC GCA GCGJ Ser Pro Thr Ala UAU UAC Tyr UGU UGC. UAA Stop UGA Stop UAG Stop UGG Trp CAC CAGGin CAU His Select an answer and submit. For keyboard navigation, use the up/down arrow keys to select an answer. AAU Asn AAA Lys AAG. There is no start codon, resulting in no translated protein. GAU ASP GAC Glu GAA GAG G CGU CGC CGA CGG Cys AGU AGC AGA AGG Arg GGU GGC GGA GGGJ Arg ser Gly MCAG U UCAG с А SCAG U SCAG U Third letterThe piece of eukaryotic mRNA below includes the region that codes for the binding site for the initiator tRNA needed in translation. 5'-GUUUCCCGUAUACAUGCGUGCCGGGGGC-3' Using the table below, which amino acid would you expect to be on the tRNA that is the first to bind to the A site of the ribosome? AGC AGA AGG GCA CGA CUA GGA GGC GCC CGC AUA CUC AGU CCA UCA ACA CCC UCC ACC UUC CCG UCG ACG UUU CCU UCU GCG CGG GAC AAC UGC GAA CAA GGG CAC AUC CUG AAA GCU CGU GAU AAU UGU GAG CAG GGU CAU AUU CUU AAG AUG Ala Arg Asp Asn Cys Glu Gin Gly His lle Leu Lys Met Phe Pro Ser O methionine O arginine O cysteine Ovaline UUA UUG OOOO GUA GUC UAC GUG ACU UGG UAU GUU Thr Trp Tyr Val UAA UAG UGA stop
- Refer to the information on the genetic code. Use this information to determine how many amino acids are coded for by the mRNA sequence AUGCGCAGUCGGUAG. The genetic code Second letter of codon UAU UAC JUU Phenylalanine uCU UUC Phe) UUA Leucine (Leu) UUG Tyrosine (Tyr) GCysteine (Cys) UGC 1oStop codon |UGG Tryptophan (Trp) CGU CGC UcC Serine (Ser) UCA ucc CCU cC Proline (Pro) Stop codon UAG Stop codon CAU Histidine His) CU CUC CUA CUG Arginine (Arg) Leucine (Leu) cca CAA CCA CGA Glutamine (Gin) CAG AUU AUC AUA ACU Isoleucine (le) AAU AAC AGU AGC Asparagine (Asn) Serine (Ser) ACC Threonine (Thr) ACA Methicnine ACC start codon GCU Lysine (Lys) AGA Arginine (Arg) ARC AGS GAU Aspartic acid (Asp)G0 GAC GUU GUC Valine (Val) GCC Alanine (Ab) GG Glycine (Gly GUA GUG GCA GCG GA Glutamic acid (Glu) GA GGG GAG 4 15 First letter of codon Third letter of codonReferring to the genetic code presented in Figure , give the aminoacids specified by the following bacterial mRNA sequences. Q. 5′ –UUUGGAUUGAGUGAAACGAUGGAUGAAAG AUUUCUCGCUUGA–3′Referring to the genetic code presented in Figure , give the aminoacids specified by the following bacterial mRNA sequences. Q. 5′ –GUACUAAGGAGGUUGUAUGGGUUAGGGG ACAUCAUUUUGA–3′