Please help me fill out the boxes in the worksheet
Q: Identify 2 independent helices domains Identify a disordered region In the structure, box the…
A: Proteins are essential molecules that perform many important functions in cells. They are made up of…
Q: [AktivGrid] Draw the product of the reaction of isocitrate catalyzed by isocitrate dehydrogenase in…
A: Isocitrate dehydrogenase catalyzes the irreversible decarboxylation of isocitrate to yield…
Q: Transcription factors bind to: Question 20 options: DNA regions called…
A: Transcription factors bind to: DNA regions called cis-acting elementsExplanation:The question…
Q: Identify the major and minor grooves in the DNA molecule PDB ID 141D. In addition, one end of a…
A: The DNA double helix has alternating major and minor grooves. The major groove is wider than the…
Q: 13. The structures of sphingosine and choline are given below. Draw the condensed structure and…
A: Sphingolipids has sphingosine as its platform molecule. Onto this sphingosine, a head group and a…
Q: The Michaelis-Menten rate equation for reversible mixed inhibition is written as Vo = Vmax [S] aKm +…
A: Hence solved.Km=[S][αV0Vmax−1]Explanation:Determine the rate constant's expression, r.First, in…
Q: Some enzymes have catalytic activity only limited by diffusion. Which rate constants of an enzyme-…
A: Diffusion is the process by which molecules move from an area of higher concentration to an area of…
Q: With regards to antibodies define the following terms in the space belowa. CDRsb. Constant regions
A: a. CDRs (Complementarity-Determining Regions):CDRs are specific regions within the variable domains…
Q: Reaction rate 0.35 0.30 0.25 0.20 0.15- 0.10 0.05 0.00 0 1000 2000 Enzyme total is 5mM 3000 4000 1.…
A: MM graph is constructed by taking substrate and reaction velocity on X and Y axes respectively. The…
Q: Considering PNPP → PNP reaction, would you expect to see more intense or pale color for the reaction…
A: para-Nitrophenylphosphate (pNPP) is a chromogenic substrate for phosphatases used in…
Q: The authors in the abstract given above describe the mechanism for the activation of metallothionein…
A: Protein Phosphatase 2A (PP2A) Binding: Complexes of PP2A PR110 bind to MTF-1, the metal regulating…
Q: The presence of the MCS in the coding region also results in us being able to express inserts…
A: The Multiple Cloning Site (MCS) is a short segment of DNA containing many (multiple) restriction…
Q: Modify the structure to show the MAJOR product that would be formed in the following reaction. HNO3,…
A: The process is electrophilic substitution.The Modified structure of the prouct is shown in the…
Q: Protease enzymes cleave proteins by hydrolyzing peptide bonds. The strategy for each type of…
A: A nucleophile is a chemical species that is negatively charged or has a high electron density or a…
Q: 3. The image below depicts 2,3-bisphosphoglycerate depicted in dark gray, and ß subunits are…
A: The objective of the question is to understand the role of 2,3-bisphosphoglycerate (BPG) in the…
Q: Problem 2
A: The objective of this question is to identify the recombinant offspring from a genetic cross between…
Q: One strand of a double-helical DNA has the sequence 5'-GCGCAATATTTCTCAAAATATTGCGC-3'. Write the base…
A: According to Watson-Crick base pairing rule, adenine (A) pairs with thymine (T) while guanine (G)…
Q: Which of the following statements regarding polynucleotides is true? a) A double stranded DNA forms…
A: The correct answer is: a) A double-stranded DNA forms a right-handed helix, where both strands run…
Q: 5. Trehalose, a disaccharide produced in fungi, has the following structure: CH₂OH H OH H H H H OH H…
A: a. α-D-glucopyranosyl-(1→1)-α-D-glucopyranoside b. Trehalose is not a reducing sugar.Explanation:…
Q: A coal fire plant uses 1 kg of coal to generate 1000 kWh of electricity and emits 50 kg of CO2 and 5…
A: The objective of the question is to understand the relationship between the functional unit (FU) and…
Q: how to use valine in a 2 chemical equation involved in this experiment using the scheme below .
A: A method for separating and analyzing amino acids in a mixture is HPLC Ion Exchange Chromatography.…
Q: Analyse and interpret the SCAM data in Fig. 1, and make a table (remember to include a legend) to…
A: SCAM (Substituted Cysteine Accessibility Method) is an analytical technique which is used to study…
Q: 2. Shown below is a dipeptide. HN- HO. OH a. Over which pH range will the dipeptide predominantly…
A: An amino acid is a biomolecule with a hydrogen atom, an amino group, a carboxyl group and a…
Q: Which irreversible inhibitor is also known as a substrate analog? affinity label transition-state…
A: Irreversible inhibitors play a crucial role in biochemical research and drug development by…
Q: Do Km and Vmax get affected by available enzyme concentration? Explain.
A: Enzymes are proteins that catalyse biochemical reactions. Michaelis Menten postulated that free…
Q: please explain the question, i am unable to input values of x
A: The dependent variable, the reaction rate (µmol/L/min), is usually plotted on the y-axis and is…
Q: The enzyme urease increases the rate of urea hydrolysis at pH 8.0 and 20 °C by a factor of 10¹4.…
A: timeuncatalyzed = 5.70x108 yearsExplanation:The given information indicates that urease increases…
Q: The bacterial gene shorty (sh) encodes for a small protein. The DNA sequence of the sh gene is shown…
A: The objective of the question is to identify the coding and template strands in the given DNA…
Q: The following phenylboronate is a competitive inhibitor of a chymotrypsin-like enzyme. Unlike…
A: The competitive inhibitor is the compound that binds to the active site of the enzyme where the…
Q: The peptide below is placed into a buffer with a pH = 1.73 H3N-CH- CH2 NH—CH—C H3C-CH NH—CH—C NH—CH-…
A: Electrophoresis means the migration of a charged particle under the influence of an applied electric…
Q: Since two 19S regulatory subunits and a 20S catalytic unit constitute the 26S proteasome, why is the…
A: A peptide is a short chain of amino acid residues linked together via peptide bonds. A folded…
Q: 5'-AATGCCTCAGCCGATCTGCCTCGAGTCAATCGA TGCTGGTAACTTGGGGTATAAAGCTTACCCATGGTATCGTAG…
A: PCR is a lab technique used for amplification of target DNA sequence by using a thermostable DNA…
Q: The cofactor shown below: is an oxidizing agent is a reducing agent is a carrier of acyl groups is…
A: The given structure is of the FAD molecule. FAD = Flavin adenine dinucleotide.
Q: Consider the following Peptide: Alanine-Lysine-Glutamine-Serine-Glycine Select all that applies…
A: Peptides are short chains of amino acids linked by peptide bonds ( the bond between CO and NH in…
Q: Which of the following molecules is most susceptible to random hydrolysis? OA. None of these; all of…
A: Random hydrolysis, the non-specific cleavage of bonds by water molecules, can affect different…
Q: Provide a stepwise, arrow-pushing mechanism for the following transformation. You may use general…
A: The reaction in question involves a lysis reaction catalyzed by a lyase enzyme using the coenzyme…
Q: 7. Consider the structures shown. For each structure select all that apply. a) pentose, hexose or…
A: Answer and its explanation are given below.I hope it helps you Explanation:
Q: What is the IUPAC name of the following compound? (No need to provide E/Z designation.) CO₂H
A: IUPAC name is 3,3,6-Trimethylhept-6-enoic acidExplanation:Step 1:Rules for IUPAC Naming Find the…
Q: 4. In the reaction in which glyceraldehyde 3-phosphate is oxidized to 3-phosphoglycerate, which…
A: The process of oxidation and reduction in a reaction is collectively called Redox reaction. During a…
Q: MSA: 1. Explain the incubation conditions 2. Explain the reagents being added 3. Explain the…
A: “Since you have posted a question with multiple sub parts, we will provide the solution only to the…
Q: Extension Questions Which of the following sequences correctly represents the flow of electrons…
A: Extension questions •The correct sequence representing the flow of electrons during photosynthesis…
Q: Give 2 differences between the lagging strand and the leading strand
A: DNA replication is the process by which the double stranded DNA (dsDNA) molecules are copied to…
Q: group)? 9. Probability of finding prolines in ẞ-turns are much more in comparison to a-helices or…
A: The preference for proline residues in β-turns compared to α-helices or β-sheets is primarily due to…
Q: Genetics Question 25
A: The question is asking for the number of sister chromatids in a unicorn cell at the metaphase of…
Q: For the following reaction: HNO3 H2SO4 NO2 NO2 NO2 10% 8% 82% 1. Write a reasonable mechanism, using…
A: 1) isopropyl benzene is considered to be electron donating by positive inductive effect of its…
Q: Give 2 similarities and 2 differences between transcription and replication
A: Transcription and replication are vital processes explained in the central dogma of molecular…
Q: Question 2: Part a: Complete the table describing different components of intron removal from mRNA.…
A: Part b: Group I Self-Splicing Intron Removal from 26S rRNA in TetrahymenaGroup I introns are a class…
Q: Sketch out the binding site of Hemoglobin with oxygen bound . ( You can abstract the Heme ring out…
A: Hemoglobin is a metalloprotein that contains iron. Hemoglobin is present in the red blood corpuscles…
Q: つく 146 Bb 9146 Bb 10311 Class E Etsy Traps E Traps New Free Chat + ☆ 口出…
A: Turnover number refers to the number of substrate molecules that is converted to the product…
Q: How is plasmid DNA distinguished from coli chromosomal DNA using the Qiagen Miniprep protocol?
A: In the Qiagen Miniprep protocol, plasmid DNA is distinguished from E. coli chromosomal DNA based on…
Please help me fill out the boxes in the worksheet
Step by step
Solved in 6 steps
- Choose the enzyme and cofactors involved in the reaction of fructose-1,6-bisphosphate to fructose-6-phosphate in gluconeogenesis. H H-TOPO Fo HOTH HDH HOH MOTOPOP K E H-TOH H OPO Problem 3 of 17 A B Q D E fructose-1,6-bisphosphatase phosphoglucose isomerase glucose-6-phosphatase phosphoglycerate kinase hexokinaseEnergetic of Fructose-1 ,6-bis P Hydrolysis (Integrates with Chapter 3.) The standard free energy change (G) for hydrolysis of fructose-1. 6-bisphosphate (FBP) to fructose-S-phosphate (F-6-P) and P: is -16.7 KJ/mol: FBP + H2O fructose-6-P + Pi The standard free energy change (G) for ATP hydrolysis is -30.5 KJ/mol: ATP + H2O ADP + Pj What is the standard free energy change for the phosphofructokinase reaction: ATP + fructose-6-P ADP + FBP b. What is the equilibrium constant for this reaction? c. Assuming the intracellular concentrations of [ATP] and (ADP] are maintained constant at 4 mM and 1.6 mM, respectively, in a rat liver cell, what will be the ratio of [FBP]/[fructose-6-P] when the phosphofructokinase reaction reaches equilibrium?Handwritten Identify the molecule names, enzyme name, enzyme classification and change in reaction(for glycolysis pathway)
- In class, I mentioned that fructose is metabolized differently in the liver compared to glucose. Refer to the figure shown below to calculate the number ofATPs you would expect from the metabolism of fructose in the liver. Show your work! Fructokinase Fructose Fructose-1-P АТР ADP Aldolase B Dihydroxy- acetone phosphate Glyceraldehyde АТР Triose kinase Triose phosphate isomerase ADP 4 - Glyceraldehyde-3-P Glycolysis Руruvate Acetyl-CoA Fatty acids and triglyceridesAlcohol consumption on an empty stomach results in some interesting biochemical as well as embarrassing behavioral alterations. We will ignore the lat t er. Gluconeogenesis falls; there are increases in intracellular ratios of lactate to pyruvate, of glycerol 3- phosphate to dihydroxyacetone phosphate, of glutamate to α - ketoglutarate , and of D-3- hydroxybutyrate to acetoacetate. Hypoglycemia develops rapidly Blood pH also falls. Alcohol consumption by a well - fed individual does not lead to hypoglycemia or alteration in blood pH . (a) Why does ethanol consumption result in the altered ratios? (b) Why does hypoglycemia and blood acidosis result in the hungry individual? (c) Why does the well-fed person not experience hypoglycemia?Glutamate is derived from which of the following molecules? oxaloacetate pyruvate O 3-phosphoglycerate chorismate O a-ketoglutarate
- Please select appropriate word in each bracket Glycogen provides short term energy storage primarily in liver and muscle. Defects in the enzymes that are required for either glycogen synthesis or breakdown therefore affect levels of [ Select ] ["glucose", "glycogen"] in the bloodstream and the amount of glycogen in the liver. This is exemplified by defects in [ Select ] ["glucose-6-phosphatase", "glycogen synthase"] , which is a deficit in breakdown and delivery, whereas mutations compromising [ Select ] ["glycogen synthase", "glycogen debranching enzyme"] result in a defect in synthesis, but defects in either enzyme produce [ Select ] ["hypoglycemia", "hypothermia"].Acetyi CoA Oxaloncetate CoA NADH Citrate NAD Isocitrate Malate Funiarate NAD co NADH FADH, FAD a- Ketoghutarate Succinate co, NAD+ ATP Succinyl CuA NADH ADP - P For each molecule of glucose (C6H12O6) oxidized by cellular respiration, how many moles of CO2 are released in the citric acid cycle? (see the figure above) а. 2 b. 4 с. 6 d. 0 е. 3C Phosphoglycerate enolase coo O H-C-O-P=O CH₂OH 2-Phosphoglycerate This is a (an) d Tyrosine hydroxylase HO coo NH3 L-Tyrosine This is a (an) 0₂ coo C-O-P-C || CH₂ Phosphoenolpyruvate H₂O + HO HO L-DOPA H₂O coo NH3
- The coenzyme NAD+ is required for which glycolytic reaction shown below? Oglyceraldehyde-3-P→ 1,3-bisphosphoglycerate glucose glucose-6-P fructose-6-P→ fructose-1,6-BP 2-phosphoglycerate → phosphoenolpyruvateWhich of the following monosaccharide phosphates is NOT produced in the pentose phosphate pathway? O seduheptulose-7-phosphate O mannose-6-phosphate O ribose-5-phosphate O erythrose-4-phosphateWhich of the following glycolytic enzymes catalyzes the conversion of fructose-1,6-bisphosphate into the two product molecules dihydroxyacetone phosphate, and glyceraldehyde-3-phosphate? phosphoglycerate kinase pyruvate kinase malate dehydrogenase aldolase phosphofructokinase