Row A. B. C D. Protein Synthesis in an Animal elect the row below that correctly identifies the name of Process 1 as well as a sequence that could represent Structure 1. Sequence of Structure 1 CGA ATT GTA CAA CGA AUU GUA CAA CGA ATT GTA CAA CGA AUU GUA CAA Process 1 transcription transcription translation translation Structure 1 Process 1 Structure 2 Process 2

Row A. B. C D. Protein Synthesis in an Animal elect the row below that correctly identifies the name of Process 1 as well as a sequence that could represent Structure 1. Sequence of Structure 1 CGA ATT GTA CAA CGA AUU GUA CAA CGA ATT GTA CAA CGA AUU GUA CAA Process 1 transcription transcription translation translation Structure 1 Process 1 Structure 2 Process 2

Name: RowAB.CDProcess 1transcriptiontranscriptiontranslationProtein Synthes
Uploaded: 2024-03-20T06:42:41.000Z
Channel: Bartleby
Description: RowAB.CDProcess 1transcriptiontranscriptiontranslationProtein Synthesis in an Animal CellSelect the row below that correctly identifies the name of Process 1 as well as a sequence that could represent Structure 1.Sequence of Structure 1CGA ATT GTA C

Biochemistry

6th Edition

ISBN:9781305577206

Author:Reginald H. Garrett, Charles M. Grisham

Publisher:Reginald H. Garrett, Charles M. Grisham

Chapter30: Protein Synthesis

Section: Chapter Questions

Problem 2P

See similar textbooks

Similar questions

Exploring the Structure of the 30S Ribosomal Subunit Go to www.pdh.org and bring up PDB file 1GIX, which shows the 30S ribosomal subunit, the three tRNAs, and mRNA. In the box on the right titled â€˜Biological Assembly.â€� click â€œMore Images.â€� and then scroll down to look at the Interactive Vic By moving your cursor over the image, you can rotate it to view it from any perspective. a. How are the ribosomal proteins represented in the image? b. How is the 16S rRNA portrayed? c. Rotate the image to see how the tRNAs stick out from the structure. Which end of the tRNA is sticking out? d. Where will these ends of the tRNAs lie when the 50S subunit binds to this complex?
Chart is Given for you: Below is a chart of values for actual enzymes. Enzyme Km (M) kcat (1/s)Chymotrypsin 1.5 × 10^−2 0.14Pepsin 3.0 × 10^−4 0.5Tyrosyl-tRNA synthetase 9.0 × 10^−4 7.6Ribonuclease 7.9 × 10^−3 7.9 × 10^2Carbonic anhydrase 2.6 × 10^−2 4.0 × 10^5Fumarase 5.0 × 10^−6 8.0 × 10^2 Assume the enzyme concentration is equal across all samples (and is equal to 1). (Answer a and b only)a. Which enzyme will have the highest V0 at very high substrate concentrations? (1 M). Why? b. Which will have the highest V0 at very low substrate concentrations (5.0 × 10^−12). Why?
I. A protein, X, was Isolated from a pathogenlc mlcroorganism. The proteln Is a vlrulence factor whose path0genlclty lies In a heptapeptide of unknown sequence. After trypsin cleavage of the heptapeptide from protein X, the peptlde's compOsition and sequence was determined. The fOllowing were the results of the sequenclng process: 1. When the peptide was treated with dinitrofluorobenzene (DNFB), DNP-asp and a mixture of amino acids were produced. 2. When the same Intact peptide was treated with streptococcal protease, a pentapeptide of composition asp, asN, cys, gly and ser and 2 amlno acids were released. 3. When the heptapeptlde was also treated with hydrOxylamine HCI, a tripeptide and a tetrapeptide were obtained. The C-terminal amino acid of the tripeptide was asN. 1) What is the sequence of the heptapeptide if it is composed of cys, asp, lys, asN, gly and ser only? 2) What is the pl of the heptapeptide?
Molecular Biology (Biol-L211) Dr. Nole Central Dogma Practice - Processes The general flow of genetic information is diagrammed below. Think carefully about what type of molecule is represented by each item in the diagram and clearly address each of the following. A. Label each structure as mature mRNA, pre-mRNA, protein, or DNA. B. Label each arrow to indicate which is processing, transcription, replication, and translation. C. Identify the general location (on the appropriate molecule) of the promoter sequence and the terminator sequence. D. Identify the specific location of the place where the start codon and stop codon function most directly. E. Where does RNA polymerase bind to begin transcription? F. Where specifically does the ribosome bind to begin translation-i.e., what are the ribosome binding sites and where are they found? G. Label each end of the mature mRNA and the polypeptide to correctly specify polarity. (You should use the labels 3', 5', C-terminus, and N-terminus.)
e.) ( acid buffer an appropriate choice? Why or why not? If I need to perform an enzymatic reaction at pH 6.5, is a citric )Describe the process of transcription in as much detail as possible using pictures and words beginning with a paired (duplexed) strand of DNA and ending with a processed mRNA which is ready for translation. 7.
Molecular Biology (Biol-L211) Dr. Nole Central Dogma Practice - Processes The general flow of genetic information is diagrammed below. Think carefully about what type of molecule is represented by each item in the diagram and clearly address each of the following. A. Label each structure as mature mRNA, pre-mRNA, protein, or DNA. B. Label each arrow to indicate which is processing, transcription, replication, and translation. C. Identify the general location (on the appropriate molecule) of the promoter sequence and the terminator sequence. D. Identify the specific location of the place where the start codon and stop codon function most directly (i.e., which molecule is actually translated?). E. Where does RNA polymerase bind to begin transcription? F. Where specifically does the ribosome bind to begin translation-i.e., what are the ribosome binding sites (in both prokaryotes and eukaryotes) and where are they found? G. Label each end of the mature mRNA and the polypeptide to correctly…
You continue to study the expression of the hexose kinase gene and capture the following electron micrograph of the gene being expressed. MRNA 1 20 ORI 40 60 TTCGAGCTCTCGTCGTCGAGATACGCGATGATATTACTGGIAATATĞGGGATGCACTATC 5' 3' AAGCTCGAGAGCAGCAGCTCTATGCGCTACTATAATGACCA'NTATAÇCCCTACGTGATAG CACTATC promoter RNA polymerase ribosome
Given: Cryo-EM structure of PCoV_GX spike glycoprotein 1. What can you tell me about the identity of the protein? 2. What is the importance of this protein?
proteins. Which of the following will tell you whether a protein would be found in the lumen of the ER? A. You run a hydropathy plot an look for hydrophobic peaks that span 20-30 amino acids B. You isolate microsomes and see whether the proteins are inserted into the membrane of the microsome C. You run a hydropathy plot an look for a lack of hydrophobic peaks that span 20-30 amino acids O D. You do in vitro translation of each protein in the presence or absence of microsomes and look to see whether there is a size change in the presence of microsomes.
4A. Write out the chemical equations (structures are not necessary) for the two steps in the reaction catalyzed by aminoacyl tRNA transferase. Include all products and reactants. Step 1: amino acid activation Step 2: aminoacyl transfer to the tRNA 4B. Write the chemical equation for the net reaction catalyzed by aminoacyl transferase. This can be determined by taking the sum of the two reactions above.
8:52 Protein 1-10092015113603.pdf https:api.schoology.comv1attachment169963839... Name Class Date Section Protein Synthesis pages 148-153) 7-3 SECTION REVIEW In this section you studied the process of pro- tein synthesis. You learned that the informa- tion that DNA transfers to messenger RNA (MRNA) is in the form of a code. When the information is decoded, chains of amino acids, called polypeptides, are formed. Polypeptides During translation, each MRNA codon in turn make up proteins, which direct biochemical pathways and are responsible for cell structure and movement. The genetic code is determined by the arrangement of the nitrogenous bases in DNA and RNA. A code word in DNA consists of a group of three nucleotides. When transcribed into MRNA, each code word, or codon, desig- nates a specific amino acid that is to be placed in the polypeptide chain. More than one codon may code for a particular amíno acid. The MANA sequence AUG serves as an initiator, or "start," codon. Three other…
wnich snows tne specinicity pockets. The S pocket nas a Ra glutamic acid in the bottom, the S2 pocket is small and hydrophobic, and the S,' pocket is deep and hydrophobic. Suggest a 3-amino acid sequence that this protease would R2 H cleave and indicate between which sites the peptide bond would be broken. S2 Which sequence would this protease cleave? Val-Lys-Phe Phe-Lys-Val Lys-Phe-Val Val-Phe-Lys Phe-Val-Lys O Lys-Val-Phe The peptide bond that is broken is between which sites? O S2 and S,' OS, and S,' O S2 and S1 O S2 and S1, and S and S,' IZ