To verify the is indeed inside your plasmid, you'd like to do a colony PCR. But you need primers for your reaction. Which of the following primer pairs would probably work for verifying your insert is actually present in the plasmid? 5' ATGTTTATTTTCTTATTATTTTTTACTCTCACTAGTGGTAGTGACCTTGACCGGTGCACCACTTTTGATG ATGTTCAAGCTCCTAATTACACTCAACATACTTCATCTATGAGGGGGG TTTACTATCCTGATGAAATTTT (Very long, but a bunch of nucleotides her e)...... TCTTGCTTTGTTGCATGACTAGTTGTTGCAGTTGCCTCAAGGGTGCATGCTCTTGTGGTTCTTGCTGCAA GTTTGATGAGGATGACTC TGAGCCAGTTCTCAAGGGTGTCAAATTACATTACACATAA 3' Forward: 5' GGT AGT GAC CTT GAC CGG 3' Tm= 59.8 OA. Reverse: 5' CAA ATT ACA TTA CAC ATA A 3' Tm= 47.4 Forward: 5' ATG TTT ATT TTC TTA TTA TTT 3' Tm= 47.1 C OB. Reverse: 5' TAT GTG TAA TGT AAT TTG ACA CCC 3' Tm= 58.4 Forward: 5' GGT AGT GAC CTT GAC CGG 3' Tm= 59.8 Reverse: 5' GTG TAA TGT AAT TTG ACA CCC TTG 3' Tm: 59.4
Bacterial Genomics
The study of the morphological, physiological, and evolutionary aspects of the bacterial genome is referred to as bacterial genomics. This subdisciplinary field aids in understanding how genes are assembled into genomes. Further, bacterial or microbial genomics has helped researchers in understanding the pathogenicity of bacteria and other microbes.
Transformation Experiment in Bacteria
In the discovery of genetic material, the experiment conducted by Frederick Griffith on Streptococcus pneumonia proved to be a stepping stone.
Plasmids and Vectors
The DNA molecule that exists in a circular shape and is smaller in size which is capable of its replication is called Plasmids. In other words, it is called extra-chromosomal plasmid DNA. Vectors are the molecule which is capable of carrying genetic material which can be transferred into another cell and further carry out replication and expression. Plasmids can act as vectors.
![QUESTION 6
To verify the is indeed inside your plasmid, you'd like to do a colony PCR. But you need primers for your reaction. Which of the following primer pairs would
probably work for verifying your insert is actually present in the plasmid?
5' ATGTTTATTTTCTTATTATTTTTTACTCTCACTAGTGGTAGTGACCTTGACCGGTGCACCACTTTTGATG ATGTTCAAGCTCCTAATTACACTCAACATACTTCATCTATGAGGGGGG
TTTACTATCCTGATGAAATTTT
(Very long, but a bunch of nucleotides her
e)....
TCTTGCTTTGTTGCATGACTAGTTGTTGCAGTTGCCTCAAGGGTGCATGCTCTTGTGGTTCTTGCTGCAA GTTTGATGAGGATGACTC
TGAGCCAGTTCTCAAGGGTGTCAAATTACATTACACATAA 3'
Forward: 5' GGT AGT GAC CTT GAC CGG 3' Tm= 59.8
O A.
Reverse: 5' CAA ATT ACA TTA CAC ATA A 3' Tm= 47.4
Forward: 5' ATG TTT ATT TTC TTA TTA TTT 3' Tm= 47.1 C
O B.
Reverse: 5' TAT GTG TAA TGT AAT TTG ACA CCC 3' Tm3 58.4
Forward: 5' GGT AGT GAC CTT GAC CGG 3' Tm3 59.8
OC.
Reverse: 5' GTG TAA TGT AAT TTG ACA CCC TTG 3' Tm: 59.4
Forward: 5' GGT CAC TAC CAC TAG TGA GAG 3' 59.4 C
O D.
Reverse: 5' GTG TAA TGT AAT TTG ACA CCC TTG 3' Tm: 59.4
Forward: 5' GGT AGT GAC CTT GAC CGG 3' Tm= 59.8
OE.
Reverse: 5' GAG CCA GTT CTC AAG GGT G 3' Tm= 60.8](/v2/_next/image?url=https%3A%2F%2Fcontent.bartleby.com%2Fqna-images%2Fquestion%2F1268647a-dc9a-4138-9f31-b5c0771d2ded%2F42af7f34-dd70-49ba-9b18-4ea3642ad1a9%2Fvxzaagl_processed.jpeg&w=3840&q=75)
![](/static/compass_v2/shared-icons/check-mark.png)
Trending now
This is a popular solution!
Step by step
Solved in 2 steps
![Blurred answer](/static/compass_v2/solution-images/blurred-answer.jpg)
![Human Anatomy & Physiology (11th Edition)](https://www.bartleby.com/isbn_cover_images/9780134580999/9780134580999_smallCoverImage.gif)
![Biology 2e](https://www.bartleby.com/isbn_cover_images/9781947172517/9781947172517_coverImage_Textbooks.gif)
![Anatomy & Physiology](https://www.bartleby.com/isbn_cover_images/9781259398629/9781259398629_smallCoverImage.gif)
![Human Anatomy & Physiology (11th Edition)](https://www.bartleby.com/isbn_cover_images/9780134580999/9780134580999_smallCoverImage.gif)
![Biology 2e](https://www.bartleby.com/isbn_cover_images/9781947172517/9781947172517_coverImage_Textbooks.gif)
![Anatomy & Physiology](https://www.bartleby.com/isbn_cover_images/9781259398629/9781259398629_smallCoverImage.gif)
![Molecular Biology of the Cell (Sixth Edition)](https://www.bartleby.com/isbn_cover_images/9780815344322/9780815344322_smallCoverImage.gif)
![Laboratory Manual For Human Anatomy & Physiology](https://www.bartleby.com/isbn_cover_images/9781260159363/9781260159363_smallCoverImage.gif)
![Inquiry Into Life (16th Edition)](https://www.bartleby.com/isbn_cover_images/9781260231700/9781260231700_smallCoverImage.gif)