Q: Do genes or alleles independently assort?
A: The alleles are the alternative forms of a gene that are located on the same locas of a homologous…
Q: The divisions of the nervous system can be divided into the central and peripheral nervous system.…
A: The type of representation of nervous system is most akin to the conceptual hierarchy.
Q: Which of the following regions of a genome would be most likely to be a SINGLE CRE? A. A section of…
A: *Genome comprises all genetic information of an organism consists of nucleotide sequences of DNA.…
Q: Ma nave 1. requires ATP A. diff 2. random movement of molecules from high to low B. fa 3. molecules…
A: Cell transport is a mechanism that brings about the movement of materials across the cell membrane.…
Q: born with sickle cell anemia. What is the frequency of individuals in this population who do not…
A:
Q: In prokaryotes, the sigma factor recognizes base sequences in the . which facilitates RNA polymerase…
A: The major step of initiation of RNA synthesis is the facilitation of RNA polymerase binding. This is…
Q: A man infected with a viral respiratory infection sneezes and releases tiny droplets containing…
A: INTRODUCTION Virus It is a microscopic infectious agent contain DNA or RNA as their genetic material…
Q: Define a ketogenic diet and give an example of a ketogenic meal. Explain why ketone supplements…
A: Introduction Cancer is a disease that develops when cells divide uncontrolled and spread throughout…
Q: Match the subfamilies of HSPGS withe their examples v syndecans and CD44V3 A. Secreted ECM…
A: Match the following. a. Perlecan and collagen XVII ---------------------------------------…
Q: In 1947, Donal Hebb took some rats home from his lab at McGill University. Hebb let these rats grow…
A: Main morphological difference between neurons of rats growing in laboratory v/s rats growing in…
Q: what is the relationship between genes and traits expressed in individuals? a) gene code for DNA,…
A: Every living organisms contain DNA as the genetic material. In case of eukaryotic cells the DNA is…
Q: What is psedupodia
A: Introduction :- A pseudopodium is a transient protrusion of a eukaryotic cell's cytoplasm.
Q: Match the subfamilies of HSPGS withe their examples v syndecans and CD44V3 A. GPI-linked…
A: Proteoglycans are mucoproteins which are formed by glycosaminoglycans that are covalently attached…
Q: 13. Compare the cells in the two photomicrographs below in terms of their shape and structure(s). А…
A: A cell consists of three parts: the cell membrane, the nucleus, and, between the two, the cytoplasm.…
Q: 1. Why do waterfowls posses an intromittent organ that is highly elaborated? 2. What happens if you…
A: Answer :- 1)Intromittent organ in waterfowl by determining the relationships between intromittent…
Q: Question 8 Why is replication called semi-conservative? A not all leading strands are conserved B…
A: During DNA duplication, is the method to copy DNA stands when new cells are formed.
Q: All of the following describe a gamete, EXCEPT: a) sperm b) haploid c) zygote d) egg
A: Gametes are an organism's reproductive cells. They are also referred to as sex cells. Female gametes…
Q: Similar genes in two separate lineages that are the result of a "lineage splitting event" A at some…
A: Species is defined as the group of individuals that can mate together.
Q: a. The scale of a spectrophotometer extends from 1 to 100% T, what are the values of these two…
A: Ans a. Absorbance of these two extremes from percent transmittance ( %T) can be calculated by the…
Q: Match the different methods of analysis with the approaches in Glycomics + Study of enzyme…
A: Introduction Glycomics is the comprehensive study of glycomes, It is the analysis of sugars or…
Q: Q4.1. The image below shows a neuron's response to a medium-intensity stimulus. Which of the options…
A: “Since you have asked multiple questions, we will solve the first question for you. If you want any…
Q: How would you proceed to separate the two bacs in the mixture when you do not have MacConkey and…
A: MacConkey is a special media, different media, indicator media basically use for gram negative…
Q: what are the 7 indicator microorganisms that must not be exist in pharmaceutical products ? how we…
A: Microorganisms aid in the creation of various foods, the manufacture of medications, the…
Q: anaerobic fates of pyruvate (conversion to lactate or ethanol) in terms of ATP production?
A:
Q: 7. RSV is a abiotic stress in plants. 8. RSV produced in the root system of plants improves the…
A: Here I discuss about RSV and their role in plants according to fill in the blank question given.
Q: Electrical impulses travelling from a point of origin to adjacent regions of the cortex is referred…
A: A sudden uncontrollable electrical disturbance on the brain is known as seizure. Causes change in…
Q: An individual cannot be a carrier for a dominant disorder they will express it. True False
A: All humans have two copies of every gene. These genes get inherited from parents to the children. A…
Q: You treat cells with 2,4 dinitrophenol (DNP). This compound creates a temporary channel in the inner…
A: DNP is a compound that is toxic and highly flammable/explosive. It uncouples oxidative…
Q: What are the three models of DNA replication? With the aid of illustrations, show how the Meselson…
A: DNA replication is an important process that takes place in all living cells. It is necessary to…
Q: How might diet soda lead to an individual feeling hungry?
A: Introduction A soft drink is a drink made up of water (typically carbonated), a sweetener, and…
Q: e the presence of saliva
A: Saliva is a thick, colourless, opalescent fluid that is constantly present in the mouth of humans…
Q: Calculate the coliform concentration in a milk sample based on the following colony counts: 10 2 :…
A: Introduction Coliform bacteria are defined as rod-shaped Gram-negative non-spore forming and motile…
Q: A strictly fermentative bacterium produces ATP A. by glycolysis only. B. by photosynthesis only. O…
A: Fermentation: It is an anaerobic process(absence of oxygen) for breaking down glucose to produce…
Q: List two possible missense mutation effects on the new polypeptide.
A: *missense mutation occurs when there is change in a single base pair that causes substitution of…
Q: Question 1: You suspect that a patient has sepsis. A. What type of specimen would you collect to…
A: *NOTE: Kindly repost for other question Dear Student as per the guidelines we are supposed to answer…
Q: The fact that some eukaryotic rRNAs are self-splicing indicates that A RNA structures are highly…
A: In eukaryotes, rRNA have a sigma factor which makes the self splicable and hence the highly variable…
Q: true or false: nondisjunction during meiosis is the cause of down syndrome
A: Down syndrome is caused by failure of chromosomes during meiosis. cell division which results in the…
Q: Question 23 All may be RNA polymerase Il promoter constituents EXCEPT: A the core element where…
A: Transcription is the process by which RNA is produced from the DNA template. This process occurs…
Q: Which of the following regions on the tRNA are composed of a sequence of nucleotides? a. anticodon…
A: The tRNA is responsible for transferring amino acids at the site of translation or protein…
Q: MULTIPLE CHOICE QUESTION Which of the following is not an example of homeostasis? Chenging…
A: Homeostasis is the phenomena occuring in the living body where constant condition is maintained…
Q: Describe one characteristic you see in organism 3 which might have had an advantage over organism 2.…
A: *Darwin proposed that Fossil records provides evidence that the living organisms has evolved a…
Q: Q4.3. After the rising phase, which ion channel is responsible for action potential returning to its…
A: Introduction An action potential is a rapid rise or an explosion of electrical activity and…
Q: Following the 5-> 3' conversion of writing nucleotide sequence, indicate which of the following MRNA…
A:
Q: 1. What causes the light pink to bright red coloraion of most adult flamingos? 2. Please describe…
A: Introduction Flamingos are a type of wading bird in the family Phoenicopteridae, they are very…
Q: Killiani Fisher Synthesis
A:
Q: Which statement is False? O B-D-glucose and B-D-galactose can be differentiated using NMR Epimers…
A: * NMR spectroscopy is used to study the physical and chemical and biological properties. *An NMR…
Q: If you examined an en-GFP transgenic fly, where would you expect to see GFP expression? O In the…
A: *GFP can be introduced to animals by using transgenic techniques will be maintained in their genome…
Q: HITCHHIKER'S THUMB: The distal (last) joint of the thumb can be bent back to form a 45 degree angle…
A: Hitchhiker thumb is encoded by gene present on autosomal chromosome. It is a recessive trait.
Q: 34-35. What is the inbreeding coefficient of 9273? O 0.00 0.065 O 0.125 O 0.25 O 0.50 0.75 1.00…
A: Only if the parents of an animal are connected is it considered inbred. Because both parents are…
Q: Neurotransmitters are released from a neuron when the action potential reaches the end of its axon.
A:
What type of DNA changes are there for c.316-106C>G mutation. Is it pathogenic?
Step by step
Solved in 2 steps
- Two possible point mutations are the substitution of lysine for leucine or the substitution of serine for threonine. Which is likely to be more serious and why?Why are structural analogs of sugar molecules (such as Oseltamivir and zanamivir) effective in treatment of influenza-virus infection?Susceptibility to developing prion diseases arises from a mutation that changes aspartic acid (Asp) to asparagine (Asn). Which nucleotide base changes could make this happen?
- What type of mutation is sickle cell anemia? Explain the molecular basis of sickle cell anemia.What is application of D_serine?A gene contains the sequence CGCATACGGTAC that results in the amino acid sequence arg-ile-arq- tyr. A mutation in this gene has a G inserted after the second C in the strand. How will this mutation affect the phenotype? A)This will affect the phenotype because although most of the protein will be identical, the first amino acid will be different. B)This will not affect the phenotype because only the second amino acid is different from the original protein. C)This will not affect the phenotype because the protein will be identical to the original protein. D)This will affect the phenotype because all of the amino acids after the first one will be different from the original protein.
- I was wondering if it is possible to provide an explanation on the structure of the PDB code 2V1X, the amino acid at position 219 and the mutation of the amino acid name LU. Thank you.What type DNA mutation is TACAT?What is c3435T mutataion,What is the clinical implication of c3435T mutation, what is the molecular characteristics of c3435T mutaion
- If the following nucleotide sequence represents the active domain of the COVID19’s M-protein 5’ ---- 5’ GGGUACAUGGUAGCCCCCGUCGAGAAAACACCC …. 3’ a) describe a potential mutation that may occur and the mechanism that could fix it b) if the repair mechanism is faulty, explain the consequences for COVID19 & that of the infected individualIdentify the type of mutation shown Original Sequence: GGC TAC ATG GAA Mutated Sequence: GGC TAA TGG AAWhich letter represents the target site of furosemide (Lasix)? E- -B