Which enzyme is used in Sanger sequencing reactions? O A. DNA polymerase O B. S1 endonuclease O C. ligase O D. reverse transcriptase O E. RNA-dependent DNA polymerase
Q: Write and submit a lab report showing any relationship between blood pressure readings of your class...
A: Introduction:- Blood pressure is a measure of the force that your heart uses to pump blood around yo...
Q: 1. Kwashiorkor, also known as «cdematous malnutrition» because of its association with edema (fluid ...
A: Kwashiorkor is a malnutritional disease caused by the lack of proteins or vitamins in the everyday d...
Q: . The genotype r/r ; p/p gives fowl a single comb, R/− ; P/−gives a walnut comb, r/r ; P/− gives a p...
A: Comb in poultry is defined by two genes usually designated as R and P. When only the dominant allel...
Q: Differentiate spectroscopy, spectrometry, and spectrophotometry
A: The study of the interaction of matter with electromagnetic radiation as a function of the wavelengt...
Q: What are the advantages and disadvantages of the presence of cranial kinesis?
A: Cranial kinesis is the term for significant movement of skull bones relative to each other in additi...
Q: If one bit is mutated on the chromosome 11010001, which of the following chromosomes cannot be gener...
A: * Mutations means change in a DNA sequence by altering the bases. *Mutations arise due to mistakes m...
Q: The part of the neuron that is usually highly branched and receives input from other neurons is the ...
A: Neurons are a particular form of cell that carry information messages or signals to and from the bra...
Q: How did the industrial revolution in England offer an example of natural selection?
A: Introduction In this question we will discuss how did the industrial revolution in England offer an ...
Q: Why is ropiness usually observed at the center of the bread and not on the sides?
A: Ropiness of the bread is due to the Bacterial spoilage which starts as an unpleasant odour and then ...
Q: If a mutation that inactivated telomerase occurred in acell (telomerase activity in the cell = zero)...
A: Telomers are the ends of the linear chromosomes.
Q: A.If the diploid human chromosome number (2n) =46, what will be the chromosome number per cell in ea...
A: Meiosis is the cell division process that involves division of a diploid (2n) mother cell and produc...
Q: Cure for Beriberi In 1887, a strange nerve disease attacked the people in the Dutch East Indies. Th...
A: Observations: The victims showed the following symptoms; weakness and loss of appetite. Moreover dea...
Q: Match the hormones involved in calcium homeostasis below with the glands or organs that secrete them...
A: Calcium homeostasis refers to the maintenance of a constant concentration of calcium ions in the ext...
Q: For each species, all______ in the complete set of chromosomes is the____ . a. genomes; library c. m...
A: Chromosomes are the thread-like structures that appear during cell division.
Q: Which of the following distinguishes axial filaments from flagella? Flagella are short and axial ...
A: Axial filament and flagellum both help in locomotion.
Q: Given your knowledge of temperate biomes, why can temperate seasonal forests retain more of their so...
A: Biome refers to the community of flora and fauna with are like characters concerning the environment...
Q: For the following DNA sequence: 3-CGATACGGCTATGCCGGCATT-5' The the sequence of the complementary DNA...
A: Complimentary base pairing Base pairing take place between a purine and pyrimidine. In DNA, adenine ...
Q: What are the important lessons in "Bases of Biological Classification"?
A: The branch of biology that deals with the classification are named taxonomy. The biological c...
Q: 45
A: Steps of Enchondral Ossification Cartilage > Bone Detailed sequence elucidated in part 2
Q: What percentage of the cells in a strawberry contains DNA?
A: Introduction: DNA stands for 'deoxyribonucleic acid' and it is the hereditary material in humans and...
Q: DNA differs in composition from RNA in having deoxyribose and uracil rather than ribose and thymine....
A: FALSE. DNA differs in composition from RNA in having deoxyribose and thymine rather than ribose and ...
Q: In humans, wavy hair is a dominant trait and straight hair is recessive. 80% of the individuals in a...
A: The population which is ideal in nature is found in Hardy Weinberg equilibrium. The ideal population...
Q: What are plankton, nekton and benthos?
A: Introduction Thereare three types of aquatic living organisms that can be classified as plankton, ne...
Q: (a)Describe the characteristic and features of a nerve cell observed under high power objective in m...
A: Nerve cells, also known as a neurons, are the active component of the nervous system. Neurons commun...
Q: Linear eukaryotic DNA molecules have many origins of synthesis. True False
A: In case of prokaryotes circular DNA present. Prokaryotic circular DNA contain single origin for rep...
Q: What is the formula for net primary production (NPP)? How does NPP relate to energy pyramids?
A: Introduction In this question we have to write the formula for net primary production (NPP) and have...
Q: 3. Identify the IMVIG pattern of the following tubes. For set of tubes that is E. coli positive, ide...
A: IMViC test are individual four tests that is - indole test methyl red test voges-proskauer test &...
Q: You are investigating the transport of proteins into the ER in various mutant cells. Where would you...
A: Transport into the endoplasmic reticulum (ER) is the important step inside the biosynthesis of maxim...
Q: are venules blood reservoirs ?
A: At any resting point of time, Venous System is said to occupy 70% of the total circulating blood vol...
Q: Describe the various post-translational modifications of HIF- 1alpha and how it affects the regulati...
A: Describe the various post-translational modifications of HIF- 1alpha and how it affects the regulati...
Q: Which Class I element has likely experienced the greatest accumulation of mutations compared to its ...
A: Transposable elements are the Jumping genes which are the mobile genetic material within the genome....
Q: How does biological diversity relate to the characteristics of the abiotic factors of an ecosystem?
A: Introduction In this question we will discuss about how biological diversity relate to the character...
Q: Explain the Restriction Enzymes ?
A: An enzyme derived from microbes that breaks DNA molecules at specified sequences is known as a restr...
Q: What is the hypothesized relationship between Specific Metabolic Rate and Osmotic Stress?
A: Metabolic rate is rate at which metabolism occurs in organism.
Q: What Data is included in a population pyramid, and what is the purpose behind the three groupings?
A: A population is defined as a group of individuals which can inter breed with each other and produce ...
Q: Describe safety measures put in place for genetic modification.
A: The Food and Drug Administration (FDA), Environmental Protection Agency (EPA), and Department of Agr...
Q: Why are nematodes ubiquitous and numerous? What is the role of their cuticle in their successful pr...
A: Nematode worms are among the most ubiquitous organisms on the earth and They include free-living fo...
Q: Dopamine is an inhibitory neurotransmitter released into neuromuscular synapses Patients with Parkin...
A: Parkinson disease is a disease of central nervous system. Currently there is no cure of disease.
Q: Marfan syndrome (Section 13.5) is inherited in an autosomal dominant pattern. What is the chance tha...
A: Introduction:- Marfan syndrome is a connective tissue disorder caused by a genetic mutation. Mutatio...
Q: Which of the following is not a key property of hereditarymaterial?a. It must be capable of being co...
A: Introduction DNA serves as the main genetic material in various organisms be it prokaryotes or Euka...
Q: Which form of RNA acts as a blueprint for polypeptide biosynthesis by the ribosome? O a. FRNA O b. R...
A: Messenger RNA (mRNA) is a type of RNA that transports the protein blueprint from a cell's DNA to its...
Q: Young's modulus for bone has a constant value for all bones
A: Young's modulus is defined as the ratio of Tensile stress to tensile strain. And it tells how easily...
Q: Miguel went to the dentist, who performed a procedure that eliminated his tooth pain. The next time ...
A: There is a relationship between the stimulus and the behaviour. Our behaviour can change according t...
Q: Explain the advanatges and disadvantages of savior baby therapy and what are the three main ethical ...
A: A savior baby or savior sib is a kid who is planned so as to supply an organ or cell transplant to a...
Q: . The production of pigment in the outer layer of seedsof corn requires each of the three independen...
A: Let Pr be purple, pr be red and acr be yellow. Part A. The phenotype of parent P1 = AA CC RR prpr ...
Q: In complementary base pairing which of the following base parings is incorrect? a. G-C b. G-T OC. A-...
A: ANSWER'- b) G-T Explain;-G-T is incorrect pair. Base pairing happens between a purine and pyrimidin...
Q: Humans have respiratory structures from the gut, for fishes, they’re not.
A: The respiratory system of humans consists of, nasal cavity, trachea( wind pipe) , the main bronchus,...
Q: Red-legged frogs (Rana draytonii) breed from around November to late April,while yellow-legged frogs...
A: There are 2 Rana aurora. The first, Rana aurora, or we can say the Northern Red-legged frog, occupie...
Q: Determines the order of the four chemical building blocks - called "bases" - that make up the DNA mo...
A: A nitrogenous base is a molecule with the chemical characteristics of a base and contains nitrogen. ...
Q: Discuss the 4 components of Medicare. Where are these 4 components applicable and why is it importan...
A: There are 4 parts of Medicare:- Part A, B, C and D Part A:- In Patient/ Hospital Coverage Part B:- ...
Trending now
This is a popular solution!
Step by step
Solved in 2 steps
- Which of the following enzymes are NOT used in recombinant DNA technology O A. Eco RI O B. Ligase O C. Lysozyme O D. T4 polymerase O E. Terminal transferaseWhich DNA polymerase in prokaryotes is involved in the replacement of primers with deoxynucleotides? a.DNA-Pol I b.DNA-Pol II c.DNA-Pol Ill d.DNA-Pol IVFour enzymes are listed below, match each to the correct definition. Definition Enzyme 4. Ligase 5. Primase 6. Gyrase 7. Helicase Answer a. Unwinds DNA b. Relieves tension in DNA during unwinding c. Links sugars and phosphates together d. Builds RNA primers C В A
- The enzyme responsible for the joining of Okazaki fragments is a. helicase b. primase c. DNA ligase d. DNA topoisomeraseMolecule involved in joining segmented nucleotide strands is... O a. DNA ligase O b. Ribosomes c. RNA polymerase d. DNA polymerase ge F5 F6 F7 F10 Scrol F8 F9How would a PCR reaction be affected if there are no primers in the reaction? a. The PCR reaction will not commence O b. The reaction will cease after a few cycles OC PCR would proceed normally O d. Non-specific PCR of random templates will occur Clear my choice
- Which of the following molecules has RNA-dependent DNA polymerase activity? A. DNA polymerase I B. DNApolymeraseIII C. RNApolymeraseD. LigaseE. TelomeraseIf you have got the following DNA template molecules, which one of them will require more energy to break down the hydrogen bonds between the antiparallel strands? O a. ATATATATCGCGTTAAATTCTA O b. GCGCGCGCGCGCGCGCGCGCG O c. AAAAAATTTTTCCCCCGGGGG O d. TACTACACTGTGGTTAATTAAA O e. GGGGGCCCCCAATTCCCCCCC tune of proteins that heln in regulating the levels of different molecules in human body, e.ga. Pfu Polymerase b.dNTPs c.Buffer Match each component above to the correct function(s) listed below. Write your selection(s) for each component. You may have more than one answer for each. 1. unwinds DNA 2. synthesizes new DNA strands 3. enzymatically catalyzes Quikchange 4. nucleotide source for new DNA strands 5. Energy source for reaction(s) 6. Repairs errors in base pair matching 7. Maintains pH and salt levels 8. Creates polymer chains
- Some bacteria, through natural selection, have acquired some extremely potent enzymes that destroy viral DNA, thereby preventing the bacterial cell from becoming infected with the virus. These enzymes are called: Select one: O a. DNA polymerases O b. DNA ligases c. restriction endonucleases O d. restriction ligasesThe DNA polymerase I uses its to remove the RNA primers during DNA replication in E. coli cells. Select one: a. 3' to 5' exonuclease activity O b. 3' to 5' DNA helicase activity O c. 5' to 3' exonuclease activity O d. 5' to 3' DNA polymerase activitycatalyzes the cleavage of DNA at a specific ii fragments. The statement given above is completed nucleotide sequence. splices DNA into by the information in row Row i ii A. DNA polymerase DNA ligase B. restriction DNA ligase endonuclease DNA Ligase restriction endonuclease restriction endonuclease С. D. restriction endonuclease A OB C D