Without Inhibitor [substrate], mM Rate (Vo), mM/min 0.997774599 With Inhibitor Rate (Vo), mM/min 0.847401 1 1.5 1.076855826 0.973852 2 1.122873947 1.037991 2.5 1.160626292 1.068431 3 1.184072485 1.105866
Q: You have a sample – sample 1 - that has a concentration (✗) particles. From this you take 1 mL and…
A: Dilution is the lab procedure used for lowering the concentration of the solute in a solution by…
Q: d. e. fo HO -OH NH2 n blood HO n H3C SCOA OH HO NH CH3
A: Reactions mechanisms are basically jumping of electrons within and between the reactants. Based on…
Q: 8 From the Hill Plot below, the of the first binding event for the receptor-ligand system under…
A: The hill plot is a graph drawn based on the Hill equation given below.This identifies with the…
Q: You are working as a protein engineer. You decide to work on lacl protein ( This is the repressor…
A: An operon is a cluster of genes under a single promoter. The gene products of genes in an operon are…
Q: (a). The product of the reaction has two chiral centers as shown: The Ca atom of the amino acid…
A: To determine the L/D configuration of amino acids, place the alpha carbon () in the center, the…
Q: 3. What is the IUPAC name of the following compound? NH2 NH2
A:
Q: Please write it out
A: Detailed Explanation - 1. Hydrolysis of Sucrose (Not in Muscle):Sucrose, a disaccharide, isn't…
Q: None
A:
Q: __________ is never involved in the initiation of eukaryotic transcription. Question 4 options:…
A: The answer is sigma factor.Explanation:All of the factors have something to do with initiation of…
Q: 12. Consider a protein that can exist in two forms: folded (F) and unfolded (UF). Calculate the free…
A: (i.) ΔGunfolding = 2100.30 J/mol or approximately 2.10 kJ/mol (ii.) ΔGunfolding = -5446.52 J/mol…
Q: The authors in the abstract given above describe the mechanism for the activation of metallothionein…
A: Protein Phosphatase 2A (PP2A) Binding: Complexes of PP2A PR110 bind to MTF-1, the metal regulating…
Q: Consider the following Peptide: Alanine-Lysine-Glutamine-Serine-Glycine Select all that applies…
A: Peptides are short chains of amino acids linked by peptide bonds ( the bond between CO and NH in…
Q: STEM Workplace Practices Q3
A: The objective of the question is to understand the purpose of release-testing in the context of…
Q: Which of the following statements regarding polynucleotides is true? a) A double stranded DNA forms…
A: The correct answer is: a) A double-stranded DNA forms a right-handed helix, where both strands run…
Q: Histone modifications are inherited across ________ but not ________. Question 6 options:…
A: Histone modifications are inherited across mitosis but not meiosis. Histone modifications are…
Q: Arrange the steps of performing the test to detect the presence of the glycoproteins indicating…
A: The objective of the question is to arrange the steps of performing the test to detect the presence…
Q: Question 5
A: The question is asking whether a mouse would die if it was injected with a mixture of heat-treated S…
Q: Find the structure of insulin online.Draw the tripeptide at the beginning of the Chain A and the…
A: Insulin is a peptide hormone composed of two polypeptide chains, usually referred to as Chain A and…
Q: Transcription factors are a specific type of nuclear proteins. How do transcription factors get…
A: Transcription factors are proteins that bind to the specific DNA sequences in or around the…
Q: (Biochemistry topics: Glycolysis, Citric Acid Cycle, and Electron Transport.) There is a reciprocal…
A: In the reciprocal regulation of glycolytic and gluconeogenic reactions, the interconversion of…
Q: 5'-AATGCCTCAGCCGATCTGCCTCGAGTCAATCGA TGCTGGTAACTTGGGGTATAAAGCTTACCCATGGTATCGTAG…
A: PCR is a lab technique used for amplification of target DNA sequence by using a thermostable DNA…
Q: 1. From the given DNA strands:a. Identify the template and non-template strand.b. Give the mRNA…
A: The answers are:(a) Template Strand:3' - G T A T A T C A G T T A G A G C T A A T C - 5' Non-template…
Q: Your colleague handed you a novel strain of coli that is purifying a protein with a 6xHisTag; they…
A: Detailed ExplainationCompetitive Metal Chelation:Dicarboxylic acids, such as citric acid, have…
Q: When 10 micrograms of an enzyme with a molecular mass of 80,000 Daultons (grams/mol) is added to a…
A: Before going into the calculations for finding the turnover number (kcat), we need to convert…
Q: For every molecule of glucose produced, gluconeogenesis consumes: O2 ATP and 2 NADH ☐ 4 ATP and 1…
A: For every molecule of glucose produced during gluconeogenesis, the process consumes 6 molecules of…
Q: Model 1 - Linear electron flow during the light reactions Identify each of the numbered elements…
A: Answers are given below:1. O22. H2O3. Primary Acceptor4. Pq (Plastoquinone)5. Cytochrome complex6.…
Q: The most important contribution to the stability of a protein's conformation appears to be the: ○ A)…
A: The most important contribution to the stability of a protein's conformation appears to be the:…
Q: 1. Draw the Fisher projection of D-glucose, and from Fisher to Haworth projection of ẞ-D-glucose.…
A: The configurations of the D-glucose are: R , S , R , RIn β−D−glucose C1 -OH is present on the up…
Q: PLease help me fill in all the information
A: 1. Pyruvate to Alanine:Pyruvate is a three-carbon compound produced during glycolysis, which is the…
Q: Corona virus tes with a 5% false positive rate and a Corona virus infection rate of 5% in Canada, if…
A: The objective of the question is to calculate the probability that a person who tests positive for…
Q: In no more than two sentences each describe electroporation
A: There are several methods or techniques that allow us to introduce foreign DNA into the host cell,…
Q: Refer to figure 1D of the Science Article. Which produces the greatest inhibition of PDE…
A: In the experiment described, the researchers tested the inhibitory effects of different…
Q: List three important characteristics of plasmids and their function
A: Here is the Three important characteristics of plasmid and their functions.Autonomous…
Q: Describe how the shape and size of nucleotides are important in the structure of double-stranded…
A: Nucleotides that make up DNA are composed of 3 components; a deoxy ribose sugar, a phosphate and a…
Q: Melting Temperature (Tm) of a dsDNA molecule is the temperature at which a 100% of…
A: The correct answer is:c. 50% of the dsDNA exists in a single-stranded (denatured) form.…
Q: A drawing of a cell in anaphase is provided. The cell contains 8 unreplicated chromosomes with…
A: Self explanatoryHope the answer was helpful. If any doubts feel free to ask for further…
Q: 2. Match the following molecules with the-corresponding test reagents that are used to identify…
A: Biochemical tests are very important in the field of biology and biochemistry. These tests are used…
Q: 3. Acetylcholinesterase is a serine hydrolase enzyme im- portant in nerve signal transmission,…
A: Approach to solving the question: Enzyme reactions. Detailed explanation:1. here's an arrow-pushing…
Q: draw the mechanism for the glyoxalate cycle enzyme malate synthase typed solution
A: The glyoxyate cycle is an alternative pathway that allows the organism to convert acetyl CoA to…
Q: What is this TLC's Rf Value
A:
Q: Identify the product of the given reaction. IV I II III heat ? = III IV
A: Option (d) III is correct See solution in image Explanation:
Q: Question 1: Part a: Graph Y = [I] / (Ki + [I]) as a function of [I] and Ki = 2 µM; and describe the…
A: Part a:The equation Y = [I] / (Ki + [I]) represents a fractional saturation curve, often used in…
Q: The cofactor shown below: is an oxidizing agent is a reducing agent is a carrier of acyl groups is…
A: The given structure is of the FAD molecule. FAD = Flavin adenine dinucleotide.
Q: An a helix would be destabilized MOST by ○ a glycine residue adopting alpha-helical backbone…
A: The stability of an alpha-helix is influenced by various factors including the propensity of amino…
Q: In a tabular form list two differences between heat shock and electroporation as methods of…
A: Transformation is the process by which a cell takes in naked DNA from its environment. Heak shock…
Q: 2. Compare and contrast the biological roles of the following amino acids the following pairs of…
A: The objective of this question is to compare and contrast the biological roles of three pairs of…
Q: 2. Draw the ringed form of D-glucose with the following modifications: (a) Convert to sugar acid at…
A: Below answer given Explanation:Step 1:(A) Step 2:(B)(C)&(D) Step 3: Step 4:
Q: 111: 900 Page 3 (b) Construct an energy-level diagram of 2-pentene showing the relative energy…
A: Already done Explanation:Step 1: Step 2: Step 3: Step 4:
Q: 12. What value do O-linked saccharides serve for membrane surface proteins? Which amino acid…
A: O-linked saccharides, also known as O-linked glycans, are carbohydrates that are attached to…
Q: Vmax Km x10 TOOLS
A: Vmax and Km are the two important parameters in enzyme kinetics.Vmax is the maximum rate of an…
PART IV. HOW FAST DOES IT GO?
Another member of your research group studied the kinetics of the
GAPDH from the organism. They also determined if the GAPDH from
the organism is also inhibited by the known inhibitor of GAPDH from
humans.
A. From the following data, determine the KM (Michaelis-Menten Constant) and the Vmax
(maximum velocity) of the enzyme without and with the inhibitor.
B. If GAPDH is inhibited, what specific type of inhibition is observed?
Unlock instant AI solutions
Tap the button
to generate a solution
Click the button to generate
a solution
- Cimetidine is used in the treatment and management of gastric ulcers and gastroesophageal reflux disease. In the case of an active ulcer, cimetidine can be administered continuous by IV infusion at a dose rate of 37.5 mg/hr. If the concentration of the cimetidine solution is 6 mg/ml, then how many milliliters must be available for a 4-hr infusion?Misoprostol is used to prevent NSAID-induced gastric ulcers. A daily dose consists of two tablets administered four times each day. What is the size of one day’s dose if each tablet contains 100 mcg of misoprostol?Based on the USP XXII and NF XVIII, list the part of a monograph of the following: crude drug, natural product, and natural derivatives. The given question to me is: What is a pharmacopeial monograph? Based on the USP XXII and NF XVIII, list the part of a monograph of the following: crude drug, natural product, and natural derivatives.A 65-year-old woman presents with ER-positive breast cancer. Explain the relevance of this diagnosis for the clinicians’ decision to treat the patient with aromatase inhibitors. Explain in-depth (around 500 words)
- rug-B has an elimination half-life of 9 hours, an absorption half-life of 20 minutes and linear harmacokinetics. In a patient, the plasma concentration five hours from the administration of two 60 mg cablets of the drug is 8 ug/mL. What would you expect to be the plasma concentration five hours from the administration of one 60 mg tablets? 1 ug/mL Answer 1-1What is DEA number ? why we use this number in the prescription? what is the importance of DEA number?(a) Community-wide mask wearing may contribute to the control of Covid-19 by reducing the amount of emission of infected saliva and respiratory droplets from persons with subclinical or mild Covid-19. However, of concern is the manner in which they are disposed of and becoming a threat to the environment. Depending on the material, these masks could last years, even decades, in the environment due to the fact that they are not biodegradable. As a khalifah, you decided to design the facemask that can minimise the pollution. In order to do that, you have to: (ii) Propose with proper justification for the material/s to be considered for this application
- what are the effects of PSTMB shown and why is it important to show effects of PSTMB in vitro effects of PSTMB on LDHA? https://www.nature.com/articles/s41598-019-40617-3Now answer the following questions: 1. Is this patient experiencing a disorder affecting anaerobic or aerobic metabolism? a) disorder affecting anaerobic metabolism. b) disorder affecting aerobic metabolism. c) None of them d) Both 2. You decide to perform assays to check the activity of one or more metabolic enzymes in the red blood cells. Which enzyme(s) would you check? a) Amylase b) Enzymes of pentose phosphate pathways c) Transaminase enzymes d) hexokinase, phosphofructokinase, and pyruvate kinaseDoris has reconstituted a bottle of Cefprozil® Oral Suspension to fill a patient's prescription. The prescription calls for 400 mg CefprozilⓇq12h for 7 days. Doris needs to know if the amount of reconstituted medication in the bottle will be enough to last the patient for 7 days. Calculate the total amount of medication in the bottle after this medication has been reconstituted: TEVA Seferle, PA 18960 PHARMACEUTICALS USA SHAKE WELL BEFORE USING KEEP THIS AND ALL MEDICATIONS OUT OF THE REACH OF CHILDREN 5 mL (approx. one teaspoonful) of suspension. Phenylketonurics: This product contains 10.1 mg of phenylalanine per Store constituted suspension in refrigerator. Discard after 14 days Ruv. A 7/2005 L52974 NDC 0093-1075-78 CEFPROZIL for Oral Suspension USP 125 mg/5 mL* Each 5 mL, when constituted according to directions, contains 125 mg anhydrous cetprozil, Ronly 75 mL (when mixed) TEVA To the Pharmacist: Prepare suspension at time of dispensing. Add to the bottle a total of 59 ml water.…
- Ivermectin is being vaunted as a cure for covid-19. Is it a primary or secondary metabolite? Discuss its origin, manufacture, use, and contraindications. Show its chemical structure.Comment on the ethics surrounding the development of the Pfizer-BioNTech.AET is called differently in European Pharmacopeia and Japanese Pharmacopeia, what are these names?