10. Transcription is 11. Translation is 12. Which feature distinguishes the sugar from DNA and RNA?_ 13. Which RNA carries an amino acid during protein synthesis? 14. During translation are attached to the end_tRNA unit. 15. The sequence of one strand of double stranded DNA is 5'-AGCGTCG-3'. The sequence of the complementary strand is (Using the biochemistry convention 5'→ 3' 16. In the genetic code how many nitrogen bases (in a codon) are required to add one amino acid during translation?

10. Transcription is 11. Translation is 12. Which feature distinguishes the sugar from DNA and RNA?_ 13. Which RNA carries an amino acid during protein synthesis? 14. During translation are attached to the end_tRNA unit. 15. The sequence of one strand of double stranded DNA is 5'-AGCGTCG-3'. The sequence of the complementary strand is (Using the biochemistry convention 5'→ 3' 16. In the genetic code how many nitrogen bases (in a codon) are required to add one amino acid during translation?

Name: do all typed answer plz very easy 10. Transcription is11. Translation
Uploaded: 2024-03-20T06:42:41.000Z
Channel: Bartleby
Description: do all typed answer plz very easy 10. Transcription is11. Translation is12. Which feature distinguishes the sugar from DNA and RNA?_13. Which RNA carries an amino acid during protein synthesis?14. During translationare attached to the_end_tRNA unit.1

Human Heredity: Principles and Issues (MindTap Course List)

11th Edition

ISBN:9781305251052

Author:Michael Cummings

Publisher:Michael Cummings

Chapter9: Gene Expression And Gene Regulation

Section: Chapter Questions

Problem 17QP: Given the following mRNA, write the double-stranded DNA segment that served as the template....

See similar textbooks

Similar questions

Which of the following is not made out of RNA? the carriers that shuffle amino acids to a growing polypeptide strand the ribosome the messenger molecule that provides the code for protein synthesis the intron
The AUC and AUA codons in mRNA both specify isoleucine. What feature of the genetic code explains this? complementarity nonsense codons universality degeneracy
Given the following mRNA, write the double-stranded DNA segment that served as the template. Indicate both the 5 and the 3 ends of both DNA strands. Also write out the tRNA anticodons and the amino acid sequence of the protein encoded by the mRNA message. DNA: mRNA: 5-CCGCAUGUUCAGUGGGCGUAAACACUGA-3 protein: tRNA:
8. Below is a double stranded DNA: ATATGTGGTCTCGG TCCGTTAGGCAAT TATACACCAGAGCCAGGCAATCCGTTA 8.1. Which strand functions as the transcription template, the top one or the bottom one? Explain your reasoning What is the MRNA transcript and polypeptide from this strand? In the space below, copy the DNA strand that is transcribed, and write the MRNA transcript. 8.2. 8.3. Identify the polypeptide chain below it. Align the MRNA and polypeptide so that it is clear which DNA bases they came from.
1. Given the piece of MRNA: 5'-CCUGCAGUAUGAAACGCCUGGUAGAAGGUGGGAAGUGGUGCGCC-3' 1. Predict the DNA strand sequence from which it was transcribe 2. List the complementary non-coding DNA Sequence 3. List the Amino acid Sequence of the protein coded for. Use the Genetic Code 2. Below is a short segment of a DNA molecule. Translate the DNA codon into MRNA. 5'- TACCATGAGAATTGTGG TCACCTTTTT-3' 3'- ATGGTACTCTTAACACCAGTGGAAAA A-5' MRNA Sequence Amino Acid Sequence
10. A portion of 5'-AUGCCACGAGUUGAC-3'. What amino acid sequence does this code for? To answer the question please: I) explain what is the genetic code and list the properties of the genetic e 2) draw a diagram of protein synthesis; 3) determine which tRNA should be attached to the mRNA; 4) what is the anticodon for the very first tRNA that will attach to mRNA? mRNA molecule has the sequence an
20. TRNA stands for transfer RNA, since a tRNA molecule transfers an amino acid to the growing protein molecule. You could also think of tRNA as translation RNA. Explain how tRNA molecules help the ribosome to translate the sequence.of nucleotides in mRNA to i sequence of amino acids in a protein. To see the process of translation in action, watch "Translation" at https://www.biointeractive.org/classroom-resources/translation-basic-detail. 21a. Fill in the blanks to label each type of molecule in this figure. a.tRNA $ & 7 8 9.
1. Create a DNA sequence with eighteen nucleotides. Indicate its 3’ on the left and 5’ on the right since that’s the template strand you will need in the next question to transcribe the mRNA. 2. Transcribe the DNA sequence above and separate the triplets into codons. Indicate 5’ and 3’ in the correct location on the strand. (Don’t worry about splicing- assume that the pre- mRNA is the same as the mature mRNA sequence) 3. Look at the genetic code, and indicate which amino acid is coded for by the codons in the above mRNA. 4. ANSWER BELOW QUESTIONS: A. First write the original DNA strand. Indicate where the substitution was by either circling it or writing it in a different color. Then write the mutated DNA sequence with the point mutation (aka substitution) wherever you choose for it to be. Again, circle it or write it in a different color. Do the same for the transcribed mRNA. Repeat the directions for 2 and 3 for this new DNA stand. (i.e., include the mRNA and translated protein…
1. What is the nucleotide sequence of the complementary strand of the DNA molecule: 5’-AATGCGATCTTCAT-3’?2. What is the nucleotide sequence of the mRNA transcribed from the template DNA strand: 3’-GCTACAAAAAGTCCATAATCGC-5’? Indicate the 5’ and 3’ ends.3. If the mRNA sequence you obtained in question 2 were to be translated, what would be the sequence of amino acids? Indicate the N-terminal and C-terminal amino acids.
3. The sequence of bases on an mRNA strand is AAUCGACGCCCGACUAGC. List the codons present in this sequence. 4. List the tRNA anticodons that would pair with the codons present in the above sequence of mRNA. 5. Determine the translated amino acid sequence obtained from the mRNA strand given in question 3. You may use the genetic code table to translate. 6. A tRNA anticodon has the base sequence CCG. Identify the DNA base sequence that was used to produce the codon that will bind it to this anticodon. 7. Explain how you would determine whether a single chain of nucleotides is RNA or DNA. 8. Describe all the elements required to carry out the process of translation. 9. Describe the importance of DNA in determining the structure of a particular protein.
26. Using the following DNA strand, write out the mRNA, and then the amino acids. DNA: 3' T- A- C- A- A- G- T- A- C- T- T- G- T- T- T- C- T- T- A- A- A 5' A LIGUULAUGAOLAAAGAAUUL Phe- MRNA: Amino Acids: met Phe- met Asme -LyS- G la- 27. Suppose the two guanosine (G) nucleotides in3 above were changed to two cytosine (C) nucleotides. What is the new amino acid chain? 28. Suppose the two guanosine (G) nucleotides in #3 were removed from the DNA strand. How would this mutation affect the amino acid chain? Write out the new amino acid chain.
1. DNA: 3’ TACAGTCTGTAGCGTACATTATCGTGACCGACT 5’mRNA:polypeptide chain: 2. a. From the given DNA sequence above, change one base in codon 6 to show nonsense mutation.Rewrite the resulting DNA sequence below and encircle the base that you changed.DNA:mRNA:polypeptide chain:b. Identify the type of base pair substitution that you applied in codon 6 3. a. From the given DNA sequence above, change the third base in codon 4 to show missense mutation. Rewrite the resulting DNA sequence below and encircle the base that you changed.DNA:mRNA:polypeptide chain:b. Identify the type of base pair substitution that you applied in codon 4 4. a. From the given DNA sequence above, change one base in codon 8 to show same sense mutation.Rewrite the resulting DNA sequence below and encircle the base that you changed.DNA:mRNA:polypeptide chain:b. Identify the type of base pair substitution that you applied in codon 8 5. Add an A before codon 3 or delete the middle base in codon 3 to show the shift of reading…