5. A promoter is a sequence of choose one: (amino acids / bases / DNA/RNA / 5-carbon sugars). Promoter sequences are recognized and bound by several different kinds of molecules that are all choose one: (nucleic acids / proteins / lipids / carbohydrates / enzymes). The molecules that interact with promoters include the transcription catalyst which is called and regulatory molecules called These regulatory molecules determine which of the following. (choose all that apply) a) how much of this mRNA will be made, b) what DNA this cell will make. c) which cell types will make this mRNA, d) what time during development this mRNA will be made, e) what protein this gene will make.

5. A promoter is a sequence of choose one: (amino acids / bases / DNA/RNA / 5-carbon sugars). Promoter sequences are recognized and bound by several different kinds of molecules that are all choose one: (nucleic acids / proteins / lipids / carbohydrates / enzymes). The molecules that interact with promoters include the transcription catalyst which is called and regulatory molecules called These regulatory molecules determine which of the following. (choose all that apply) a) how much of this mRNA will be made, b) what DNA this cell will make. c) which cell types will make this mRNA, d) what time during development this mRNA will be made, e) what protein this gene will make.

Name: 5. A promoter is a sequence of choose one: (amino acids / bases / DNA
Uploaded: 2024-03-20T06:42:41.000Z
Channel: Bartleby
Description: 5. A promoter is a sequence of choose one: (amino acids / bases / DNA/RNA / 5-carbon sugars).Promoter sequences are recognized and bound by several different kinds of molecules thatare all choose one: (nucleic acids / proteins / lipids / carbohydrat

Biology: The Dynamic Science (MindTap Course List)

4th Edition

ISBN:9781305389892

Author:Peter J. Russell, Paul E. Hertz, Beverly McMillan

Publisher:Peter J. Russell, Paul E. Hertz, Beverly McMillan

Chapter16: Regulation Of Gene Expression

Section: Chapter Questions

Problem 6TYK

See similar textbooks

Similar questions

1. Contents of the diagram below was discovered in the 1960s. Explain in detail what this diagram is demonstration and define each component? Where is the CAMP-CRP binding site? Where is the RNA polymerase binding site of the promoter? What is the position of the Transcription start site? Promoter I gene Z gene CAMP-CRP binding site RNA Polymerase binding site Operator MRNA DNA sequence -100-90 一B0 -70 -60 -50一40 -30 -20 -10 +1 +10 十20 小30 +40) MetN -Thr - Met
1. Draw a simplified model of a cis-regulatory element with multiple trans-acting factors up-regulating gene expression. Your simplified model must include: a double-stranded DNA molecule labeled with its appropriate orientation (3' and 5', etc.), an area of DNA highlighting the gene of interest to be transcribed, a highlighted area showing the promoter region, one cis-regulatory element upstream of the promoter with its specific transcription factor • RNApol + a general transcription factor + a TATA binding protein all bound to the appropriate area (think about where these bind before transcription starts), an upstream enhancer with its transcription factor bound to it, • and finally the TSS. All parts must be labeled and in the correct area to earn full credit. **I suggest using different colors for this drawing problem**.
1. (a) Binding of transcription activator protein Gene is switched ON Gene is switched OFF Does NOT affect the gene expression (b) the RNA polymerase binds at the promoter region Gene is switched ON Gene is switched OFF Does NOT affect the gene expression
3. Differentiate between factors and processes involved in transcription: Recognition of this DNA sequence is [Choose] required for transcription to initiate:. [ Choose ] PROMOTER Occurs when the ribosome reaches a RNA POLYMERASE stop codon on the MRNA TERMINATION INITIATION SITE ENHANCERS The main enzyme responsible for transcribing DNA into RNA is ELONGATION Will increase the efficiency of gene [Choose] expression, but are not essential for transcription. RNA polymerase "walks" along the template strand, adding a [Choose ] matching (complementary) RNA nucleotide to each existing ncleotide. The section of DNA from which the [Choose ) very first 5" RNA nucleotide is transcribed Question 4 1 pts hp 近

1. The following is the partial DNA sequence of Gene A. Note: The underlined sequence (from position 20-54) represents the promoter for Gene A and the underlined and italicized sequence (from position 71-90 represents the ribosome binding (RBS) site of Gene A. Transcription begins at and includes the bold T/A base pair at position 60. 10 20 30 40 50 60 70 --- 5 ATCGGTCTCGGCTACTACATAAACGCGCGCATATATCGATATCTAGCTAGCTATCGGTCTAGGCTACTAC 3 TAGCCAGAGCCGATGATGTATTTG TATATAGCTATAGATCGATCGATAGCCAGATCCGATGATG Promoter 80 90 100 110 120 130 140 --- 5' СAGGTAТCGGTCTGATСТАССТАGСттстсттстстстстсССССGCGGGGGCTGTACTATCАTGCGTCG 3 GTCCATAGCCAGACTAGATCGATCGAAGAGAAGAGAGAGAGGGGGCGCCCCCGACATGATAGTACGCAGC RBS 150 160 170 180 190 200 210 --I- - -I- -- 5 TCTCGGCTACTACGTAAACGCGCGCATATATCGATATCTAGCTAGCTATCGGTCTCGGCTACTACGTAAA 3 AGAGCCGATGATGCATTTGCGCGCGTATATAGCTATAGATCGATCGATAGCCAGAGCCGATGATGCATTT What are the first 4 amino acids encoded by Gene A? Write the N and C terminal ends. Hint: Find the DNA coding strand,…
3. Animation 11.3: Refer to the table. Step Description RNA polymerase and other transcription factors bind to TFIID to form the initiation complex. The initiation complex initiates transcription. TFIID binds to TATA box at the promoter site. D. A regulator protein binds to the regulator region and to the initiation complex. In which order do these steps occur just before expression of a gene in a eukaryotic cell? O A D-B C OC- A- D → B O C- D– A – B O D B→C A dreamsite estime deamstiee
1. In a couple of sentences, explain how eukaryotic activator proteins (that are usually gene-specific transcription factors) can enhance transcription even when bound to sequences hundreds or thousands of nucleotide pairs away from a gene’s promoter. 2. Describe three common characteristics of transcription factors. The characteristics may relate to structure, or mechanism of action (PLEASE ANSWER BOTH PLEASE)
. One mechanism by which antisense RNAs act as negative regulators of gene expression is by base pairingwith the ribosome binding site on the sense mRNA toblock translation. In a second, alternative mechanism,the act of transcribing an antisense RNA can somehow prevent RNA polymerase from recognizing thesense promoter for the same gene. Design an experimental approach that would enable you to distinguishbetween these two modes of action at a specific gene.(Hint: What would be the outcome in each case ifhigh levels of the antisense RNA were transcribedfrom a gene on a plasmid?)
A bacterial species has a hypothetical sigma promoter that has the following sequence: TTGGCA - 18 bases - TATAAT What change in the level of transcription would there be if the sequence was mutated to: TTCGCA -18 bases -TATAAT O The mutation would bind the promoter to the consensus and produce normal levels of transcription O The mutation would inhibit the promoter thereby inhibiting transcription The mutation would move the promoter away from consensus and reduce the level of transcription O No change the consensus TATAAT sequence in the same. D00 F3 F4 F5 F6 F7 F8 F9 % & 5 6 7 8 9 %24
1. Which of the histones below are capable of transcriptional activation? H2B H3 H4 All of the above 2. Amino acid residues on monomeric G protein that are attached to ATP : Glycine and Serine Threonine and Hisidine Glycine and Glucine Glycine and Threonine 3. Which one of the below has receptors located in the cytoplasm? EGFR ErbB2 Retinoids Neu 4. What would occur in a cell if the concentration of external signaling molecules decreases? less receptors will be bound more receptors will be bound no receptors will be bound all receptors will be degraded
1. Shown below is the diagram of a eukaryotic gene that encodes a protein. The promoter and transcription start sites are indicated on the map. The numbers shown correlate with nucleotide base position along the DNA sequence. Transcriptional Transcription start site occurs at base position 1 terminator 5100 Promoter 5' Exon 1 Intron 1 Exon 2 Intron 2 Exon 3 3' 100 Positions 1100 2000 3000 4000 200-202 Start codon positions 4801-4803 Stop codon а. Where in the above sequence where RNA polymerase will bind? b. How long (in bases) will the primary mRNA transcript of this gene be? How long (in başes) is the processed mRNA transcript? С.
2. You are excited because you discovered a DNA sequence motif that appears to be in the promoters of very highly expressed genes. You suspect that it is the binding site for a transcription factor (TF). The problem is, that you can't identify the TF! The motif you found is: A-A-T-C-G-C/G-A/T-A/T-C/G-A/T where 'X' is any nucleotide and '/' denotes either of the two nucleotides. a) You give up trying to identify the TF and decide that you are going to engineer your own TF. How might you go about synthetically creating a novel TF that best targets this sequence? What considerations would you need to take into account here? b) How might you go about confirming that this sequence is indeed important for gene expression?