8:20■■ LTE< Spring 2024 - Senior Comprehensives (...Question 6ɔ (ividitudtory)In the Lac operon, what happens when allolactoseattaches to the repressor protein?a)b)c)the repressor is induced to attach to thepromoterRNA polymerase is induced to attach to theoperatorlactose synthesis enzymes are produced bygenes Z, Y,Ad) the repressor is inactivatedQuestion 88 (Mandatory)What is the purpose of X-chromosome inactivation inmammals?a) It accomplishes dosage compensation.b)It assists in the interactions beteeen genesTra and Dsx.c) It prevents trisomy from occurring.d) It produces the testis determination factor.Question 94 (Mandatory)Duchenne muscular dystrophy is inherited in an X-linked recessive pattern.A female is known to be heterozygous for Dumuscular dystrophy XD xd

Detailed explanations for each question: Question 5: In the Lac operon, what happens when…

Answered: 8:20 ■■ LTE < Spring 2024 - Senior…

Biology: The Unity and Diversity of Life (MindTap Course List)

15th Edition

ISBN:9781337408332

Author:Cecie Starr, Ralph Taggart, Christine Evers, Lisa Starr

Publisher:Cecie Starr, Ralph Taggart, Christine Evers, Lisa Starr

Chapter10: Control Of Gene Expression

Section: Chapter Questions

Problem 15SQ

See similar textbooks

Similar questions

What is the difference between a repressible and an inducible operon?
Cell and Molecular Biology Subject: 1. Explain how the actions of the lac operon are different from the trp operon. 2. Why is it important for a multicellular organism to be able to turn on only some of its genes in any particular tissue or cell type?
127. Whicn of the following statement concerning the regulator gene (i) associated with the lac operon is correct ? (1) MRNA is transcribed from the i-gene whether lactose is present or not. (2) MRNA is transcribed from the i-gene only when lactose is not present (3) Lactose inhibit the synthesis of mRNA from i-gene (4) Lactose promotes the synthesis of mRNA from i-gene
10- 00 O SCNSA-SCN10A CDKN1A HANDI VTI1A SYTI • MYOCD 9 10 11 12 13 14 15 16 17 18 19 20 2122 X Y
15b what is an attenuator? (in context of a prokaryotic operon )
Choose correct option and do explain plz. 1. The protein complex that helps RNA polymerase to cross nucleosomes during extension is:a. SWI-SNFb. poly A polymerasac. TFIISd. FACT 2. The polydenylation is carried out by:a. primaseb. polymers poly ac. a reverse transcriptased. adenylyltransferase 3. The lactose operon produces a polycistronic mRNA that includes four genes: Lacl, LacZ, LacY and LacA. True or false?
40-How can understanding the gene expression pattern in a cancer cell tell you something about that specific form of cancer? 1-In E. coli, the trp operon is on by default, while the lac operon is off. Why do you think that this is the case?
Describe how RBPs can prevent miRNAs from degrading an RNA molecule.
A scientist discovers a virus encoding a Protein X that degrades a subunit of the elF4F complex. Knowing that this virus transcribes its own mRNAs in the cytoplasm of human cells, why would Protein X be an effective virulence factor?
Discuss Concepts In a mutant strain of E. coli, the CAP protein is unable to combine with its target region of the lac operon. How would you expect the mutation to affect transcription when cells of this strain are subjected to the following conditions? Lactose and glucose are both available. Lactose is available but glucose is not. Both lactose and glucose are unavailable.
16. During early life many infants receive milk from the mother. One of the major components of milk is lactose. a) Consider the Lac operon in E. coli, and state what the expression of Lac Y would be in I) E. coli WT (wild type, everything is functional) and II) E. coli whose lacl gene has been delet- ed, when each of the 2 strains are growing in culture flasks that contain high glucose and high lactose. Hint: choose among 'high expression; low expression; no expression'for I) and II). 1) II) b) In the graph below, draw the expression of LacY over time in strains I and II, when each of the 2 strains are growing in culture flasks that contain high glucose and high lactose, as shown in part a). Hint: you can draw the curves on a piece of paper and copy and paste a picture of it, if it is difficult to draw the graph directly here. If you do so and you have a Mac, make sure to convert your exam into PDF by doing "Print > Save as PDF"; do not “Export as PDF". time (min) Make sure to label…
GTTTTCACTGGCGAGCGTCATCTTCCTACT 8. What is the function (e.g. transcriptional regulation, transmembrane signaling, kinase, protease, etc.) of the protein(s) encoded by the gene.

SEE MORE QUESTIONS

Recommended textbooks for you

Biology: The Unity and Diversity of Life (MindTap…

Biology

ISBN:

9781337408332

Author:

Cecie Starr, Ralph Taggart, Christine Evers, Lisa Starr

Publisher:

Cengage Learning

Biology: The Dynamic Science (MindTap Course List)

Biology

ISBN:

9781305389892

Author:

Peter J. Russell, Paul E. Hertz, Beverly McMillan

Publisher:

Cengage Learning

Biology 2e

Biology

ISBN:

9781947172517

Author:

Matthew Douglas, Jung Choi, Mary Ann Clark

Publisher:

OpenStax

Biology: The Unity and Diversity of Life (MindTap…

Biology

ISBN:

9781337408332

Author:

Cecie Starr, Ralph Taggart, Christine Evers, Lisa Starr

Publisher:

Cengage Learning

Biology: The Dynamic Science (MindTap Course List)

Biology

ISBN:

9781305389892

Author:

Peter J. Russell, Paul E. Hertz, Beverly McMillan

Publisher:

Cengage Learning

Biology 2e

Biology

ISBN:

9781947172517

Author:

Matthew Douglas, Jung Choi, Mary Ann Clark

Publisher:

OpenStax

SEE MORE TEXTBOOKS