A gene for albumin has 5 exons. When the DNA from this gene is allowed to hybridize with nuclear pre-mRNA, how many R loops will be formed? a) 1 b) 2 c) 3 d) 4
Q: * 15-14 AG AG is +6.64 kJ/mole +1.59 kcal/mole for the reaction Citrate - = Isocitrate. is -267…
A: Since conditions inside the cell are different than standard temperature and pressure, biochemists…
Q: If the target protein is 0.1% of the total protein in the original mixture, a three-step…
A: Purification is a process by which impurities are removed from a sample and desired component is…
Q: Fill out the last column of this table: Component 1X concentration 20X (Provide unit)
A: The dilution factor tells us how much of the original stock solution is present in the final…
Q: What is the role of HCO3 in the activity of pancreatic enzymes? 2. What factors are needed in the…
A: DISCLAIMER FOR MULTIPART Since you have posted a question with multiple sub-parts, we will solve…
Q: What is the isoelectric point of the following peptide molecule?…
A: The pH at which a specific molecule carries no net electrical charge is known as the isoelectric…
Q: COMPLETE ALL CALCULATIONS REQUIRED FOR TABLE 1 ( For all measurements, the [PNPP] concentration will…
A: P-Nitrophenyl phosphate Assay is an enzyme assay conducted for the enzyme alkaline or acid…
Q: When tissue of the body are unloading CO2 into the blood, what best describes what happens to most…
A: Hemoglobin is a protein found in RBC. In addition to carrying oxygen from the lungs to the tissues,…
Q: What is the total number of moles of ATP generated per mole of glucose in the glycolytic pathway and…
A: Cellular respiration is a collection of three metabolic pathways that generate ATP by the oxidation…
Q: Which of the following correctly illustrates a dipeptide and an amino acid in the optimal position…
A: Proteins are composed of amino acids, which are bound together by peptide linkage. Amino acids…
Q: OOC 1 H₂C H₂C H₂C-C HC H₂C NH NO HN Coo 1 CH₂ T CH₂ C-CH, CH C-CH₂ G=CH₂ "OOC 1 H₂C H₂C T H₂C H₂C-C…
A: Hemoglobin has four subunits, in which each has a heme group. The heme group is a heterocyclic…
Q: Give an overview of Tumor necrosis factor (TNF) signaling, and discuss the nature of the TNF ligand…
A: TNF signaling is an apoptotic signaling pathway that causes programmed cell death due to external…
Q: [1-14C] Ribose 5-phosphate is incubated with a mixture of purified transketolase, transaldolase,…
A: The pentose phosphate pathway consists of 2 phases; Oxidative and Non-oxidative phase. In the…
Q: Question 6 In membranes, one of the most common targets of reactive oxygen species are saturated…
A: Fatty acids are carboxylic acids with a hydrocarbon chain. Saturated fatty acids are fatty acids…
Q: The initial velocities of two different enzyme-catalyzed reactions were measured over a series of…
A: Michaelis Menten postulated that free enzyme reacts with the substrate reversibly to form an…
Q: Both myoglobin and hemoglobin can adopt both T and R states. Both myoglobin and hemoglobin bind to…
A: Hemoglobin and Myoglobin: In terms of primary sequence, myoglobin and hemoglobin are only distantly…
Q: Draw a lipid structure. Properly label the polar and non-polar ends of the representation of a lipid…
A: Lipids are bio molecules that are made up of fatty acids and glycerol. They are insoluble in water…
Q: Enzymes as biological catalysts of metabolic reactions. Properties of enzymes as protein substances.
A: Enzymes are biological catalysts that increases the rate of biochemical reactions. Most enzymes are…
Q: Pathological Constituents of Urine Fill in the table below for your observations Pathological…
A: Since you have posted a question with multiple sub parts, we will provide the solution only to the…
Q: The word root erythr/o means?
A: INTRODUCTION : Word roots in medical field - In the field of Medical science , a different and…
Q: Ketohexoses commonly exist in living systems in either the straight chain or ring (furanose) forms.…
A: Carbohydrates are polyhydroxy aldehydes or ketones. They can be classified as monosaccharides,…
Q: 3. Pyrozole has been proposed as a possible nontoxic inhibitor of LADH-catalyzed ethanol oxidation.…
A: Since you have posted a question with multiple sub parts, we will provide the solution only to the…
Q: The hormone interacts with the metabotropic receptor, as a result of further implementation of the…
A: The G protein is a protein found associated with G protein-coupled receptors. The receptor coupled…
Q: Which of the following tests is used to differentiate between pancreatic insufficiency and…
A: Reduced nutrition absorption can be brought on by issues with mucosal transport or with intraluminal…
Q: Aerobic glycolysis can produce ATP at a much faster rate than anaerobic oxidative phosphorylation.…
A: Pyruvate has a distinct outcome in anaerobic environments. Pyruvate is changed into lactate by the…
Q: The Electron Transport System (ETS) The ETS must generate a hydrogen gradient (proton motive force)…
A: Since you have posted multiple questions, we will provide the solution only to the first question as…
Q: Name four amino acids that can be synthesized using pyruvate as a starting material. What one(s) of…
A: Amino acids are biomolecules that have an amino group and a carboxyl group linked to the same carbon…
Q: Briefly and in simple terms, describe the glycoside bond connecting two monosaccharides in a di- or…
A: Chemically carbohydrates are polyhydroxy aldehydes or ketones. They have the general formula :…
Q: Which of the following first messengers is a polypeptide? O acetylcholine adrenaline O insulin…
A: First messengers are biomolecules that bind to the cellular receptor to elicit a response within the…
Q: c) 1.0 1.2 Estimate Vmax and KM for all cases. What type inhibitor is [I]? Estimate K₁ and/or Kı'…
A: Enzymes are usually comprise of protein molecules which is used to catalyzed several biochemical…
Q: Draw the structures of reactants and products in the transamination in which glutamate and pyruvate…
A: In a transamination reaction, an amino group is transferred from a donor substrate to an acceptor…
Q: 1. Acetyl-CoA labeled with ¹4C in both of its acetate carbon atoms is incubated with unlabeled…
A: The citric acid cycle, also called as the Tricarboxylic acid (TCA) cycle is the central metabolic…
Q: true/false: Glutamine synthetase is responsible for the synthesis of glutamine from glutamate.
A: Both glutamate and glutamine are non-essential amino acids. These are glycogenic amino acids.…
Q: Which of the following statements is correct regarding the structures below? CHO CHO H-OH ОН H-OH -н…
A: Monosaccharides are the simplest carbohydrates. Based on the functional groups, they are classified…
Q: true/false: The cofactor ATP is essential in all transamination reactions.
A: Transamination is a reaction which results in transfer of an amino group to a keto-acid in order to…
Q: The active site of an enzyme that uses a general acid-base catalytic mechanism contains a Glu and an…
A: In simple terms, pH indicates whether a substance is acid or base. pKa determine how strong is an…
Q: 4. The figure below shows ATP in the binding site of pyruvate kinase, an important enzyme cellular…
A: Pyruvate kinase is the enzyme that catalyses the conversion of phosphoenolpyruvate to pyruvate. It…
Q: purified protein sample was used in a reaction, resulting in an activity of 696.7 nmol min-1. The…
A: The activity of protein sample refers to the quantity of active protein present in the purified…
Q: Which of the following is a structure of a sugar alcohol? Н I I H O CAB O CAR O CAP COOH OH нон CAT…
A: Sugar alcohols are formed when the aldehyde or keto group of the monosaccharide is treated with a…
Q: You are studying the DNA binding protein CLAMP and you want to determine its binding affinity for…
A: Introduction DNA acts as genetic material in our body. It is a double stranded molecule. mRNA is…
Q: 2. Another bodily process is the urea cycle. However, a carbamoyl phosphate is necessary to begin…
A: Carbamoyl phosphate is synthesized with the help of enzyme carbamoyl phosphate synthetase requiring…
Q: Please draw 2 diastereomer of the following molecule
A: Isomers are molecules with same molecular formula and different arrangement of atoms. Isomers are…
Q: Which of the following can be CANNOT be generated through anaplerosis? a) b) Citrate c) Isocitrate…
A: In the TCA cycle, acetate is converted into citrate by citrate synthase, which uses oxaloacetate as…
Q: 2. What is the terms used to describe what is happening to the members of the electron transport…
A: Electron transport system occurs in the inner mitochondrial membrane. This system causes a series of…
Q: 8. At room temperature (20 °C), milk turns sour in about 64 hours. In a refrigerator at 3 °C, milk…
A: Introduction: The term activation energy refers to the amount of energy that is required to…
Q: Calculate protein concentration in unknown samples 1, 2, 3: Absorbance of Unknown 1 = 0.541…
A: Given that the standard BSA concentration is 1mg/mL. 10, 20, 30 ,40 and 50 µL of the standard BSA…
Q: 14. Consider the molecules below and the answer questions that follow. CH-0-8-R₁ HC-0-C-R₂ 0-4-0-0₂…
A: Since you have posted multiple questions with multiple sub parts, we will provide the solution only…
Q: ОН ОН ОН tautomerization
A: Tautomerization is the process by which structural isomers interconvert between each other. The…
Q: name the reaction of the carbohydrate catabolism
A: The catabolism of carbohydrates is a series of redox reactions that produce energy from…
Q: The second step during elongation of fatty acid chain is catalyzed by B-ketoacyl reducatse. In which…
A: Simple fats or triglycerides or triacylglycerides are categorized as storage lipids. Triglycerides…
Q: In order to break the carbon-carbon bond of Acetyl-CoA in a way that does not harm the cell, citrate…
A: Glycolysis is the metabolic pathway by which 6-carbon glucose is converted into 3-carbon pyruvate in…
Give a clear explanation answer..no need handwritten
Step by step
Solved in 2 steps
- Process by which the DNA sequences encoding exons are exchanged and reordered through genetic recombination between DNA sequences encoding introns. Group of answer choices a)RNA editing b)Exon Definition c) Exon Shuffling d)TransesterificationWhich two sequences shown in the diagram are NOT directly transcribed from the template strand of DNA for this mRNA? ( select all that apply) a) The exons b) 5' cap c) 3' poly-A tail d) UGA e) AUGA single template strand of a DNA molecule is represented by 3’atgtaccatgcgcaaatttaaaggccc5’. a) Using the same strand above as a template, write the pre-mRNA transcript. b) List the molecules that must be present for DNA to be transcribed. Briefly describe their function. c) What are three modifications that happen to pre-mRNA before it becomes mature mRNA
- The following is part of the non-template strand of DNA for a gene. 5'-TACTATCATGAGAGATAGGAG-3' Which of these sequences corresponds to the mRNA after transcription A)5'-AUGAUAGUACUCUCUAUCCUC-3' B) 5'-TACTATCATGAGAGATAGGAG-3' c) 5'-ATGATAGTACTCTCTATCCTC-3' d) 5'-UACUAUCAUGAGAGAUAGGAG-3' E) N-Tyr-Tyr-His-Glu-Thr-CGiven the following DNA sequence from the template strand of a given gene: 5'CTTGCGTCACCTAAGACCTGTCATCG3' a) Write the mRNA that will be transcribed from the DNA sequence above (be sure to label the 5' and 3' ends) b) Write the peptide sequence translated from the mRNA produced in part a.A single template strand of a DNA molecule is represented by 3’atgtaccatgcgcaaatttaaaggccc5’. a) Imagine that AAG is an INTRON in the original DNA template strand above. Write the mature mRNA strand after the three modifications? b) Write the amino acid sequence of your mature mRNA. c) List the molecules involved in translation and briefly describe their function.
- Which of the following would be present in a genome but not the transcriptome? (Select all) A) Introns B) Exons C) PolyA tail D) PromoterIf you were to hybridize a eukaryotic gene to its corresponding mRNA, the two molecules would not perfectly align. Why would it not? A) Exons contained in the gene have been removed from the mRNA via splicing.B) RNA polymerase adds introns to the mRNAC) Introns contained in the gene have been removed from the mRNA via splicing.D) RNA polymerase adds exons to the mRNAWhich of the following is/are a role for the poly-A tail? (Select all that apply.) a) Facilitates transport of the transcript out of the nucleus b) Confers stability to the mRNA c) Binds to RNA polymerase to initiate transcription d) Facilitates binding to DNA
- The following is a portion of an mRNA sequence: 3’ –AUCGUCAUGCAGA-5’ a)During transcription, was the adenine at the left-hand side of the sequence the first or the last nucleotide used to build the portion of the mRNA shown? Explain how you know. b)Write out the sequence and polarity of the DNA duplex that encodes this mRNA segment. Label the template and coding DNA strands. c)Identify the direction in which the promoter region for this gene will be located.14) Why are telomeres so important in eukaryotic organisms? A) Without telomeres, important DNA could be lost every time the cell divides. B) They cap the mRNA, allowing it to pass through the nuclear membrane to the cytoplasm fo translation. C) They provide a repetitive DNA sequence needed by primers to recognize the beginning of transcription. D) They remain relatively undamaged from environmental stress and toxins.A given coding strand sequence in a Eukaryote is as follows 5'GGGAATATAA GACCGATGGA GGGTACAG CCCTATCAC GATACGCAGG ATAGCAGCA 3" a) Mark the promoter in blue and transcribe from the G after the promoter. b) Translate the mRNA made c) The mRNA made by the cell was 10 nucleotides shorter than what you have made. What could have happened? d) EXTRA practice: A particular triplet of bases in the coding strand of DNA is 5'GAC 3'. What is the amino acid for this codon and will be the anticodon on the tRNA that binds the mRNA codon?