A section of DNA has the base sequence shown in #1. A mutation in this DNA strand results in the base sequence shown in #2. What type of mutation does this change represent? #1 5' - AGCGTTACCGT-3' # 2 5' - AGGCGTTACCG-3' O a missense mutation O a point mutation a silent mutation O a frameshift mutation %23

A section of DNA has the base sequence shown in #1. A mutation in this DNA strand results in the base sequence shown in #2. What type of mutation does this change represent? #1 5' - AGCGTTACCGT-3' # 2 5' - AGGCGTTACCG-3' O a missense mutation O a point mutation a silent mutation O a frameshift mutation %23

Human Heredity: Principles and Issues (MindTap Course List)

11th Edition

ISBN:9781305251052

Author:Michael Cummings

Publisher:Michael Cummings

Chapter11: Genome Alterations: Mutation And Epigenetics

Section: Chapter Questions

Problem 9QP: Define and compare the following types of nucleotide substitutions. Which is likely to cause the...

See similar textbooks

Similar questions

BM4_DNA AND PROTEIN S X /1FAIPQLSDP_g5B-629FSHNpGnTMIEppLS4A71zBd4vcUBqNUILubXONw/formResponse 4. What is the nitrogen base pair of Adenine in transcription? O Cytosine O Uracil O guanine O thymine 5. The central dogma of Molecular Biology states that There are four nitrogen bases in DNA, two purines (adenine and guanine) and two pyrimidines (cytosine and thymine). Which process is not included in the central dogma? duplication transcription translation O translocation Leadple
Cynt Classifying mutations A certain section of the coding (sense) strand of some DNA looks like this: $-ATGTATATCTCCAGTTAG-3" It's known that a very small gene is contained in this section. Classify each of the possible mutations of this DNA shown in the table below. mutant DNA 5- ATGTATCATCTCCAGTTAG-3' S-ATGTATATCTCCAGTTAG-3 5- ATGTATATATCCAGTTAG-3' type of mutation (check all that apply) insertion deletion point silent noisy insertion O deletion point silent noisy insertion O deletion point silent Onoisy X G
EboV RNA from Guinea Pig EboV RNA from Guinea Pig GAU ACG UUC GUC AAU EboV DNA CTA TGC AAG CAG TTA Translated amino acids Asp Thr Phe Val Asn EboV Strain 1 EboV Strain 1 (Circle the mutated bases) CCA TGT AAG TGG TTA mRNA Protein Of the mutations you identified, how many are: _______substitutions __________ frameshifts The result of the caused by the mutation is (silent, missense, nonsense). Underline your answer.
EboV RNA from Guinea Pig EboV RNA from Guinea Pig GAU ACG UUC GUC AAU EboV DNA CTA TGC AAG CAG TTA Translated amino acids Asp Thr Phe Val Asn EboV Strain 3 EboV Strain 3 (Circle the mutated bases) CCA TAT AAG CAG TTA mRNA Protein Of the mutations you identified, how many are: _______substitutions __________ frameshifts The result of the caused by the mutation is (silent, missense, nonsense). Underline your answer.
G. Aureliano has a mutation in the blue-shaded nucleotide in the TEMPLATE DNA sequence. Instead of a T, he has a G. 5' AАTCАТААСТСАТTG 3' What type of mutation does he have? Missense Silent Nonsense Frameshift o000
48 Second letter If any single nucleotide is deleted from the DNA sequence shown below, what type of mutation is this? UUU U UUC UUA UCU Phe UCC UAU UGU Cys ANTISENSE 5' GGACCCTAT3' UAC Tyr UGC UAA Stop UGA Stop UAG Stop UGG Trp Ser UCA Leu UUGL" UCG CUU CU CAU) His CAC) CGU CGC CGA Arg CUC C Leu Pro CAA1 Gin CAG) CUA CCA CUG CG CGG AAU AAC Asn AGC AAA AAG Lys AGG Arg AUU ACU AGU Ser AUC lle ACC Thr AUA ACA AGA AUG Met ACG GCU GCC GUU GAU] GGU GUC Val GAC Asp GGC Ala Gly GUA GCA GAA GGA Select an answer and submit. For keyboard navigation, use the up/down arrow keys to select an answer. a FRAMESHIFT SILENT NONSENSE MISSENSE Third letter First letter
Sickle-cell hemoglobin differs from regular hemoglobin in just one amino acid. Normal hemoglobin is created from the codon GAA, which codes for glutamic acid while sickle-cell hemoglobin has the codon GUA, which codes for valine. This is an example of what type of mutation? * O Insertion O Silent mutation O Deletion O Substitution mutation
Based on the following wild type DNA sequence, indicate if each of the mutations should be classified as : insertion, deletion, missense, nonsense, silent (Use the provided Genetic Code table and remember you have been given DNA sequence). Wild Type: 5’ ATG GCT AGA GTC GAG TTG 3’ Mutant 1: 5’ ATG GCA GAG TCG AGT TG 3’ Mutant 2: 5’ ATG GCT TGA GTC GAG TTG 3’ Mutant 3: 5’ ATG GCT AGA GTT GAG TTG 3’ Mutant 4: 5’ ATG GCT AGA AGT CGA GTT G 3’ Mutant 5: 5’ ATG GCT AGA ATC GAG GTT 3’
FIGURE 5 shows the base sequence of the DNA before and after mutation. Which of the following are CORRECT about the types of gene mutation? * Normal DNA: CGA TTA CCA TGC ATA CGA TTA ACC ATG CAT A CGA TTA CAC TGC ATA I III CGA TTA CCA GGC ATA II Mutant DNA Types of gene mutation I Base Deletion II Base Substitution II Base Inversion FIGURE 5 O I and Il only O I and III only Il and III only O I, Il and III
Why do you think this substituion is named " NonSense". In your response explain what it means to have a stop codon. Use evidence from the diagram. Ready? Enter your answer here.
The coding sequences of Gene F and Gene G are shown by the double-stranded DNA below: Gene F 5' ATGGGAGCACCAGGACAAGATGGATATCATTAG 3' 3' AGTTACCCTC GT GG TCCTGTTCTACCTATAGTAS Gene G Questions: 1. Write down the messenger RNA sequence when Gene F is transcribed. 2. Write down the polypeptide chain when Gene F is completely expressed. 3. Write down the messenger RNA sequence when Gene G is transcribed. 4. Write down the polypeptide chain when Gene G is completely expressed.
The most common MCAD mutation is shown below. The coding strand is shown for both the WT and mutant. The TATA box and kozak sequences are in parenthesis. What type of mutation is present? Wild-type:5’-ATGGCC[TATAT]ATGTCACTTGACTACGCAGCC[GCCACCATGG]ATATAGATAATGCGCGCATAGCATACTGAGGGTAGTAG-3’ Mutant:5’-ATGGCC[TATAT]ATGTCACTTGACTACGCAGCC[GCCACCATGG]ATATAGATAATGCGCGC AGAGCATACTGAGGGTAGTAG-3’ Answer: Is this a transition mutation? because there is an exchange of G instead of A? It kind of confuses me a little. help