Q: Biology Question
A: The term "human evolution" or "human origins" describes how Homo sapiens evolved into a distinct…
Q: Future Uses of Citric Acid in Biotechnology
A: As defined by the National Institutes of Health, biotechnology is a broad field of biology that…
Q: In the Mexican hairless breed of dog, the lack of hair corresponds to the H/h genotype. Normal dogs…
A: Alleles are the alternative versions of a gene located at a particular location in the chromosome.…
Q: 4586 patients were recruited in a study and information was collected on their different diseases /…
A: Research methodology is a procedure which is used for analyzing the data about a topic.
Q: Give examples of antibiotics, their mode of action, target microorganism, and classify where they…
A: antibiotic is a chemical compound that is toxic to other bacteria and is generated by a living…
Q: A study is conducted to see if the presence of physical recreation related infrastructure (e.g.…
A: Study design It refers to the framework, procedures, and methods that are used to collect and…
Q: Discuss amongst yourselves the ethical principles at stake when faced with a moral dilemma and the…
A: HIPPA Law: HIPPA law is an act that is referred as Health Insurance Portability and Accountability…
Q: When separating proteins from cellular extractions, what electrophoresis method works best and what…
A: Proteins are one of the most important biomolecule in our bodies.If we want to extract proteins,we…
Q: Consider how the following symptoms might indicate deficiency of a major class of nutrients and…
A: Nutrition is the amount of food an organism needs to feed its cells and survive. Nutrients provide…
Q: 34. Which of the following best describes the epithelium in the histologic section shown? A)…
A: INTRODUCTION:- A tissue is a group of one or more types of physically linked cells…
Q: H.W: Normal value of Intensity of bone, soft tissue, fat, air, metal (stainless steel, titanium…
A: Radiographic density or X-ray density is a measure of degree of film darkening. It is the measure of…
Q: 65. Destruction of the group of cells identified by the arrows in the photomicrograph shown is most…
A: An aberrant condition of an organism that interferes with biological functions is a disease. It is…
Q: What mutations would have the greatest effect on peptide sequence? Which would have the least…
A: Introduction A mutation is a rapid, heritable alteration in an individual's phenotype. A mutation is…
Q: Health impact of digestive disorders Drag and drop each cause to the correct disorder. May be caused…
A: Heartburn: Maybe caused by reaction to medication. Maybe caused by overeating Ulcer: Maybe…
Q: Which of the following is not true of cancer cells? Select one: O a. they release a growth factor…
A: The one criteria amongst following sentences, that is not true about Cancerous cells is : ( e ) :…
Q: (ii) Complete the table comparing the light and electron microscopes. The table should fit on a…
A: Difference between magnification and resolution Resolution is the ability of optical equipment to…
Q: Which of the following is not a common nosocomial infection? surgical site infections respiratory…
A: Infections linked to medical care are referred to as nosocomial infections. infections that were…
Q: A mermaid has the following genotype. AaBBCCDd. How many gametes with different genotypes will this…
A: Alleles are the alternative forms of a gene that are located on the same locas of a homologous…
Q: 15. Now, transcribe and translate the DNA strand below. Remember to use the start and stop…
A: Transcription and translation are terms used to describe two distinct biological processes: the…
Q: You can carry out matings between an Hfr and F strain by mixing the two cell types in a small patch…
A: In the mating experiment, the Hfr bacterial strains frequently yield chromosomal gene recombinants.…
Q: 64. The graph shows the pressure-volume relationship of the lung (solid curve) and chest wall…
A: The graph is showing the pressure- volume relationship of lung and chest wall.
Q: Regarding the Endocrine System, describe the regulation of short term and long term stress response.…
A: Please follow step 2 for detailed explanation.
Q: the two questions. Congenital hypertrichosis (CH) is a very rare X-linked dominant inherited…
A: Congenital generalised hypertrichosis (CGH) is a rare collection of genetically and phenotypically…
Q: 8. Which one of the following changes is most likely to occur when the blood pressure in the kidney…
A: In the human body, there are two kidneys. They are slightly in the backside of the body, under the…
Q: Fungi have a stage of the lifecycle, not seen in other organisms, known as the what stage
A: Ans: Fungi is just like other microorganisms molds and bacteria have chitin in the cell wall. It is…
Q: A man of blood group A is being sued by a woman of blood group B for paternity. The women’s child…
A: Blood group of an individual is determined by presence/ absence of antigen on RBC 's while…
Q: The reason why lions do not develop scurvy without eating vegetable is that lions eat herbivore…
A: Scurvy is a disease carried on by a lack of vitamin C. (ascorbic acid). Early indications of a…
Q: Say, I have two offspring of my own and also three nephews in Michigan who I have never interacted…
A: The total of an organism's direct (personal) and indirect fitness is known as inclusive fitness. A…
Q: Desribe how the reproductive structures of each organism are adapted towards the given…
A: Even among different lineages, many animals share very similar reproductive structures. It's a cycle…
Q: 3. The total number of cells in a human adult body (70 kg) is estimated to be 40 trillion. How many…
A: The total no of cell in mouse of 70g is 40 million
Q: Describe the structure of the cell membrane using the terms ‘phospholipid bilayer’ and ‘fluid mosaic…
A:
Q: Is the entire strand of DNA template strand of DNA transcribed at one time? Explain answer
A: DNA is the genetic material in living organisms that is composed of polynucleotide strands. The…
Q: a practical investigation to find the solute potential of rhubarb cells was carried out in this way.…
A: The plasma membrane, also known as the cell membrane, is the membrane that divides the inside of the…
Q: Derived characters are traits: A. that are more complicated than ancestral characters B. that…
A: A derived character arises from random mutations that cause evolution and is shared by two or more…
Q: in 1995, a population of 31 gray wolves was introduced into Yellowstone National Park. The…
A: Some species live in unique climatic conditions since every living thing developed to exist in a…
Q: Acll 2297 Xmal 2294 Bcgl 2215 Scal 2177 Pvul 2066 Avall 2059 BsrDI 1935 Acil 1924 Espl 1919- Avall…
A: The insertion of a gene into a foreign gene is known as gene cloning or genetic engineering.…
Q: Regarding the Endocrine System, describe the role of insulin and glucagon in blood sugar.
A: Insulin and Glucagon are two major hormones of our bodies.These two hormones can play important…
Q: According to the film, Your Inner Monkey, grasping hands evolved: A. to allow grooming for social…
A: In relation to finger length, the human opposable thumb is longer than those of other primates.…
Q: Which of the following reactions does not occur mammals? O pyruvate + NADH-lactate + NAD+ O…
A: Introduction : All chemical processes necessary to keep cells and an organism in a live state…
Q: Explain the kidney's role in water conservation. How much water is reabsorbed (by following other…
A: Kidneys role in water conservation. Nephron is the basic structural and functional unit of the…
Q: Why does sexual dimorphism have important implications for studying human evolution? Explain why and…
A: Sexual dimorphism is a condition in which the sexes of the same species have distinct morphological…
Q: For these organisms to develop into functional offspring of that species, which one of the following…
A: Introduction Embryology is a branch of science which deals with the study of embryonic development.…
Q: CLASS AMPHIBIA-SALAMANDERS, FROGS, & TOADS The hind limbs of the frog are much longer than the…
A: A frog is a tailless, short-bodied amphibian belonging to the big carnivorous group of species. A…
Q: QUESTION 2 In a Phenome-wide Association Study (PheWAS) where we are trying to link genotypes and…
A: Phenome-wide association studies (PheWAS) searches for phenotypes that is associated with specific…
Q: If you have a friend or family member working at a high risk of a silicosis exposure-related…
A: Workers who breathe in crystalline silica experience fibrotic nodules and damage around the…
Q: A mutation was introduced to the original DNA and now you have following DNA sequence (the mutation…
A: A mutation is the change in the genetic material of an organism. A point mutation is the mutation…
Q: A gene codes for I J. complementary base pairs on DNA molecules. K. an RNA molecule. L. sequences of…
A: DNA (deoxyribonucleic acid) is two stranded, helical, ladder like structure that functions as…
Q: 1. Describe how gas exchange occurs at the gills of the fish.
A: Note: “Since you have posted multiple questions, we will provide the solution only to the first…
Q: Through diagrams with labelling and description, describe how signals such as taste and light are…
A: The sensation of taste is referred to as gustation. The different taste types that can be sensed are…
Q: A genomic library was made for a various ethnic groups, what do you think how can these data be of…
A: A genomic library is considered to be a collection of the fragments that can form the complete…
Step by step
Solved in 2 steps
- Given the following codons and their corresponding amino acids: UUU-Phenylalanine GAA- Glutamate CAA- Glutamine AAU- Asparagine AAC- Asn AAA- Lysine UCU- Serine GGA-Glycine ACC-Threonine AUG- Met/ START codon CCU- Proline GUU- Valine UAU-Tyrosine UAA- STOP AGG- Arginine AUU- Isoleucine CAU- Histidine GCU- Alanine UGU-Cysteir GAU-Asparti CUA-Leucine UGG-Tryptol CGU-Arginin Box 1: Show the mRNA sequence which codes for the short peptide, lys-ala-phe- leu. Include what should come before and after this short message. Don't leave any spaces between the letters. Box 2: Show the tRNA anticodon sequence that would line up with the mRNA strand from Box 1. Don't leave any spaces between the letters. Box 3 & 4: Show the DNA base sequence that would be found in the DNA double helix which carries the gene for this peptide. Give the coding strand sequence in Box 3 and template strand sequence in Box 4. Don't leave any spaces between the letters. Box 5: What if there was a frameshift at leucine…Draw the structure of this peptide: N-Met-His-Tyr-Leu-Asp-Ser-Arg-Leu-CThe peptide below -NH-CH- H3N-CH- CH3 NH-CH- -NH-CH- -O- -NH-ÇH- CH2 CH2 CH2 HN-ç=NH, NH2 CH2 CH2 CH Ho-CH, C-OH H,C CH3 needs to be separated from a second peptide with a primary sequence ADES. At what pH range would it be possible to separate the peptides? O 0- 2.0 O 2.5 - 3.5 O 4.0 - 9.0 O 13.0 -14.0 о 10.0-12.0
- 100All tRNA molecules have poly (A) tails at their 3' end. Yesorno5'-TAGCTGATCGAATATGCGGTCTCTATCTTCGTAGACGA-3' 3'-ATCGACTAGCTTATACGCCAGAGATAGAAGCATCTGCT -5' Determine the amino acids that will be encoded by this sequence Second letter First letter U C A G U UUU Phe UUC UUA UUG Leu CUU CUC CUA CUG Leu GUU GUC GUA GUG Val UCU UCC UCA UCGJ AUU AUC lle AUA ACA AUG Met ACG CCU CCC C CCA CCG ACU ACC GCU GCC GCA GCG Ser - Pro Thr Ala A UGU UACTyr Cys UGC. UAA Stop UGA Stop A UAG Stop UGG Trp G CAC His CAA Gin CAG GAUT GAC Asp GAA AAU Asn ACC Ser AGU AAG LYS AA Glu GAGJ Oa. N-Met-Arg - Ser-Leu-Ser - Ser-C Ob. N-Met-Pro-Arg - Asn-Asp - Ser-C d. N-Met-Lys - Val-Glu-Ala-C Oc. N-Asp-Pro-Lys - Ser - Val-Ile-C Oe. N- Met-Ala-Asp-Pro-Lys - Ser-C G CGU CGC CGA CGG AGA AGG. GGU GGC GGA GGG Arg SCAO Gly U UCAG UUA DUAG Arg G Third letter 13A At pH 5, what is the net charge of the peptide Val-His-Gln-Cys-Ser-Lys? 0 -1 0 0+1 Ⓒ +2 Q Search "de 96 5 ******* ******* 131183 J- C 8 a hp
- otein structure urs Chaperones AUG Zwitterion Tarm Aminoacyl-tRNA synthetase Unanswered 0 0/1 answered III I III A compound with no electrical charge made up of separate molecules with positive and negative charges that balance each other out. Attaches the appropriate amino acid to a tRNA molecule based on its anticodon. Surprisingly contains a thymine in it despite being a piece of RNA. Recognized by the anticodon UAC. Small group of proteins that assist protein folding. SubmitIf the sequence of DNA on the template strand of a gene is AAA, the mRNA codon produced by transcription will be and will specify the amino acid A. UUU, phenylalanine B. AAA, phenylalanine C. AAA, lysine D. TTT, arginine In the given anticodon CCA - UAU - UCG, what is the resulting amino acid sequence? A. glycine-isoleucine-serine B. histidine - serine - tyrosine C. proline - tyrosine - tyrosine D. proline - isoleucine - serine Which sequence of amino acids shows the corresponding polypeptide for DNA Sequence 3' AAGGCCGCA-5'? A. phenylalanine - arginine - arginine B. phenylalanine - alanine-alanine C. lysine - alanine - alanine D. lysine -arginine - arginineWhat is thee tRNA anticodon for the first 5’-ACGAUC-3’?
- Translate the following DNA sequence into amino acids 5'ATAGTACCGCAAATTTATCGCT3 O met-ala-phe-lys-stop O met-ala-phe-lys- met-tyr-his-gly-val-stop-met-gly O met-ala-ser-gly-thr-stop O tyr-his gly-val-stop-met-ly O ala-phe-lys stopThr-Lys-Pro-Ile-Val-Ala-Pro-Met-Glu-Tyr-Gly-Lys Write the sequence using one-letter abbreviations. sequence: TLPIVAPMGYGK Incorrect Estimate the net charge on the peptide at pH 7. charge at pH 7: +1 Estimate the net charge on the peptide at pH 12. charge at pH 12: 0 IncorrectWhat would happen if you changed the anticodon in the Tryptophan tRNA from ACC to AAC? First letter U C A G U UUU Phe UUC Phe UUA Leu UUG Leu CỰU Leu CUC Leu CUA Leu CUG Leu AUU lle AUC lle AUA lle AUG Met GUU Val GUC Val GUA Val GUG Val Second letter C A UCU Ser UCC Ser UCA Ser UCG Ser CCU Pro CCC Pro CCA Pro CCG Pro ACU Thr ACC Thr ACA Thr ACG Thr GCU Ala GCC Ala GCA Ala GCG Ala UAU Tyr UAC Tyr UAA Stop UAG Stop CAU His CAC His CAA Gln CAG Gln AAU Asn AAC Asn AAA Lys AAG Lys GAU Asp GAC Asp GAA Glu GAG Glu G UGU Cys UGC Cys UGA Stop UGG Trp CGU Arg CGC Arg CGA Arg CGG Arg AGU Ser AGC Ser AGA Arg AGG Arg GGU Gly GGC Gly GGA Gly GGG Gly O Tryptophan would be incorporated into peptides where leucine normally goes Tryptophan would be incorporated into peptides where it normally goes ○ Leucine would be incorporated into peptides where Tryptophan normally goes O Histidine would be incorporated into peptides where Leucine normally goes U C A G U C A G U C A G U C A G Third letter