Q: What is the difference among the true ribs, false ribs, and floating ribs? (Why are they labeled…
A: Introduction :- The bony skeleton, or rib cage, of the chest is made up of many pairs of narrow,…
Q: A 0.1ml aliquot of a bacteriophage stock with a concentration of 4* 10- phage/ml is added to 0.5ml…
A: The multiplication of infection (MOI) can be calculated as the number of phage per bacterium.
Q: EXPLAIN HOW MITOCHONDRIA PARTICIPATED IN CELL DEATH??
A: Apoptosis is interceded by proteolytic enzymes called caspases, which trigger cell death by cleaving…
Q: Calculate the percent oxygen saturation of myoglobin if 7 of 15 binding sites are occupied..
A: Myoglobin displays a regular curve - as you increase the concentration of oxygen, myoglobin becomes…
Q: During neuronal signaling, a change in membrane potential will cause sodium channels to open and let…
A: The sodium potassium pump, also known as the Na+/K+ pump or Na+/K+ ATPase, is a protein pump found…
Q: Relative to carrying capacity, what from unbridled continued growth population? o foto may result of…
A: Population Growth refers to the increase or decrease in the size of a population over time,…
Q: One of the characteristics of botulinum toxin (the cause of 'botulism') is a very specific protease…
A: Neurotransmitters A chemical that secreted by the ends of nerve fiber into the synaptic cleft.
Q: What are the three cons of deciduousness?
A: The word deciduous in biology describes a tree, shrub, or other plant which totally loses its…
Q: 1. Two molecules that can pass easily through the plasma membrane, between phospholipids, include…
A: Plasma membrane The membrane which is selectively permeable and allow only certain molecules to pass…
Q: Referring to the degeneracy of the genetic code, explain why alterations to the first base of a…
A: We know there are four nitrogenous bases in a DNA or RNA like adenine(A), Thymine(T) in case of…
Q: which of the following changes in the plasma membrane of a salmon is most likely to occur as it…
A: Cell membrane is made up of phospholipids and proteins. These are arranged as fluid mosaic model as…
Q: Describe the types of mutation discussed in class and the consequences these havefor the evolution…
A: A mutation is a permanent change in the DNA of a cell such that the sequence deviates from what is…
Q: What is the primary use of the antiviral drug acyclovir? Using terms already covered in class,…
A: What is primary use of the antiviral drug Acyclovir? Describe its mechanism of action.
Q: Which of the following statements correctly describes why white muscle fibers do not need is mini…
A: In vertebrates, the muscle system helps with the movements and posture of the body. There are mainly…
Q: Discuss the components of a motor unit. What is the difference between a motor unit and a motor…
A:
Q: Could the mini-prep protocol purify RNA? Why or Why not? Based in your answer, what is the…
A: RNA Miniprep protocol is the RNA isolation protocol which is available and designed for easy,…
Q: What is/are true statements about Action Potentials? Select all that apply. Group of answer…
A: Action potential is a rapid rise and fall in voltage or membrane potential across cell membrane.…
Q: Gluconeogenesis cannot use as a substrate. O Pyruvate O Alanine O Glutamate Palmitate
A: Glucose is an important carbohydrate molecule that is central to energy consumption. This glucose is…
Q: 8 10 Biosphere 2 was a failed experiment at creating an enclosed self-sustaining ecosystem. The…
A: Green house A artificial house created by humans to grow plant irrespective of there season.
Q: why must we take the human population Size into account when we attempt to develop environmental…
A: We must consider the human population size when we attempt to develop environmental restoration…
Q: A population consists of 300 individuals with the following genotypes: AA – 100…
A: Since p = 1 - q and q is known, it is possible to calculate p as well. Knowing p and q, it is a…
Q: Based on the Movement of Water across a Selectively Permeable Membrane lab, what is a selectively…
A: Introduction :- An very thin layer of protein and fat makes up the cell membrane. It is referred to…
Q: The following describes the concentration of particles in a heavily salted solution: O a Hypertonic…
A: Osmolarity is a process of measurement of solute concentration. It is the number of osmoles (Osm) of…
Q: What type of vertebra articulates to the top of the sacrum? Identify the set of tiny bones that…
A: The sacrum is a large bone located at the terminal part of the vertebral canal, where it forms the…
Q: D In the following DNA strand, find the position of the start codon, stop codon and determine the…
A: The given DNA strand - GGTACTTTATACCCTGATACATTTGTGGGG Corresponding mRNA strand -…
Q: The input region lacks _________________, but contains _____________________, Group of answer…
A: Introduction A ligand is a material that combines with a biomolecule to generate a complex for…
Q: Describe pinocytosis, phagocytosis and receptor mediated endocytosis.
A: Describe pinocytosis, phagocytosis and receptor mediated endocytosis.…
Q: Human (and fly) males are said to be hemizygous for a(n) ________ trait. Responses recessive…
A: Introduction Sex-linked traits are associated with genes that are found on the sex chromosomes. In…
Q: Why is it important to perform both quality control and assurance in a cytogenetic laboratory? Does…
A: Cytogenetics is the study of chromosome alterations, such as damaged, absent, altered, or…
Q: ) Explain homology, list and explain the different types of homologies (also give examples)and why…
A: In some species there are similar features or structurs between them which indicates they shared a…
Q: A population consists of 300 individuals with the following genotypes: AA – 100…
A: . The Hardy-Weinberg principle states that allele and genotype frequencies in a population will…
Q: b) It's said that secondary structures form because of intra- and intermolecular hydrogen bonding…
A: Proteins are one of the major 4 biomolecules, these act as building blocks of biological tissues.…
Q: Of the family of viruses we've studied, what type of virus is HIV (human immunodeficiency virus)?…
A: A virus is an infectious microbe made up of a nucleic acid segment (either DNA or RNA) surrounded by…
Q: treatment 1 has steady growth treatment 2 has stead growth treatment 3 has steady growth…
A: Positive control Positive control is the treatment that affect the growth of subject.
Q: Follicle-stimulating hormone stimulates the production of a. steroids in the adrenal cortex. b.…
A: Hormone Also known as chemical messenger of the body. They are secreted from the different gland…
Q: Hydrophillic is the following: O a. Water Loving or Water Attracting O b. Water Repelling O c. Polar…
A: Introduction :- An object that is attracted to water molecules and has a propensity to dissolve in…
Q: In transcription, the termination signal is a DNA sequence that tells RNA polymerase to A stop…
A: DNA (deoxyribonucleic acid) and RNA (ribonucleic acid) are nucleic acids and serve as carriers of…
Q: In measuring photosynthesis in crop species, you find that two species respond differently to a…
A: Introduction Plants and other living things employ a process called photosynthesis to transform…
Q: How can transposons contribute to specific human diseases?.
A: Introduction Genetics is a branch of science that deals with the study of genes, heredity, and…
Q: Please describe the detailed procedures of southern blot. Explain the protocol and principle of…
A: By separating DNA, RNA, or protein molecules according to their size and electrical charge,…
Q: 6. Some bacteria produce chemicals that provide food with a certain taste. Name two such foods.
A: Hydrochloric acid (HCl) destroys the maximum amount of bacteria in a healthy stomach. Bacteria can…
Q: Student Y is working with his microbiology experiment, the directions of the agar is to suspend 25g…
A: In microbiology experiment, we generally use 15-20ml media for each petri dish. Here we can consider…
Q: A female who is heterozygous for tongue rolling reproduces with a male who is homozygous recessive…
A: Genotype can be define as the combination of charecteristics which can be observed by our naked…
Q: 20. Which of the following rows identifies the reproductive hormone levels that coincide with severe…
A: The chemical compounds or substances secreted by cells of various glands of the endocrine system are…
Q: there is a cellular sack that is impermeable to starch molecules and is filled with a solution,…
A: Tinicity is the term we use when a solution have ability to move water in and out of the cell with…
Q: D In fava bean plant the seed color can be coded by two alleles, green (G) which is dominant and…
A: True breeding plants are those that have homozygous alleles (which means two copies of a single…
Q: Cyanide binds with metals. Based on this information, what process in aerobic cellular respiration…
A: Cellular Respiration is a process by which the cells produce energy from food in the presence of…
Q: Allosteric enzymes in biosynthetic pathways are often inhibited by the binding of a ligand. The…
A: All biological systems are well regulated. There are various regulatory things in our body, that…
Q: In the lake the biomass of plankton decreased from 65000 to 50000 kg. As a result the biomass of the…
A: In the food chain, one organism eats another. The first trophic level is of producers which include…
Q: Each spinal nerve branches into a ventral and dorsal: ganglion root tract plexus ramus
A: Introduction According to the classical doctrine of the nervous system, an animal's nervous system…
Compare and contrast cut & paste and replicative transposition.
Step by step
Solved in 2 steps
- Draw the gel electrophoretic pattern that would be seen in dideoxy sequenceanalysis of the DNA moleculeHi, I would like to know which program is used for the graphical presentation of the results of a meta-analysis of genome-wide linkage scans?Describe the technique of in situ hybridization. Explain how it can be used to map genes.
- Please briefly explain what gel electrophoresis is and how it works to separate a mixed sample of macromolecules like DNA.Comparative genomics using MAUVE: Please help interpret.Using the 5 major steps, make or create your own flow diagram of the genetic engineering process (isolation, cutting, ligation, transformation, colony screening)