Draw the structures of two dipeptides: aspartic acid-glutamine and methionine-isoleucine with NH2 and COOH at the amine and carboxylic acid ends. Show the abbreviations for both dipeptides using three-letter abbreviations and 1-letter abbreviations for the amino acid residues.
Q: Urea is an ideal way to remove ammonia from the body because: OA) it does not affect the pH of…
A: Various metabolic processes (especially protein degradation) generates free ammonium ions. Ammonium…
Q: 23. Which is a general term indicating a carbohydrate polymer? A) Glycan B) Polycarb C) Multimer D)…
A: Carbohydrates or carbs are maconutrient consisting of Carbon, hydrogen and oxygen atoms. In nature…
Q: Which of the statement/s is TRUE of electrolytes? I. They are positively and negatively charged…
A: Electrolytes are substances present in the blood and carry an electric charge. Osmosis is the…
Q: A TCL was run with 5 subjected samples utilizing a silica plate and ethanol/chloroform in mobile…
A: TLC (thin layer chromatography) is a type of partition chromatography, in which the samples are…
Q: For Asp-Cys-Lys-Arg, What are the pH buffering regions (pH range)? Charge at ph 4?
A: Peptides are made up of amino acids. Every amino acid have an alpha-carbon that is bonded to 4…
Q: 1. In an individual with a nonfunctional triose phosphate isomerase (catalyzes the conversion of…
A: Cellular respiration is a collection of three metabolic pathways that generate ATP by the oxidation…
Q: Which of the following structures represent the same carbohydrate? CHO HO но- -Н EX Н -OH HOCH2 1…
A: Carbohydrates are polyhydroxy aldehydes or ketones. The general formula of carbohydrate is (CH2O)n.…
Q: Calculate the more fraction of HC! hydrochloric water containing 30% HCl and water in a folution…
A: Mole fraction is a fraction of the number of moles of a particular component in a mixture divided by…
Q: PJA01 Based on your knowledge of local anesthetic SAR, which of the following drugs will block the…
A: Local anesthetics (LA) are drugs that block the sensation of pain caused by injury or a surgery.…
Q: data obtained by a group of students: Tube Results of Lugol's iodine Test 1 Yellow 2 3 4 5 Light…
A: “Since you have posted a question with multiple sub parts, we will provide the solution only to the…
Q: What product is formed in the committed step of the biosynthesis of pyrimidines? O a. pyrophosphate…
A: Pyrimidine biosynthesis happens in the cytoplasm with six steps process and it is synthesized from a…
Q: Give an example of how signal transduction plays a role in disease
A: Introduction Signal transduction is a process which causes a series of molecular events in cells.…
Q: Experimental results describing a protein's amino acid composition are useful for estimating the…
A: Proteins are high molecular weight polymers of amino acid residues linked together via peptide…
Q: Identify what GalNAc, GlcNAc, Frutose and Sialic Acid are, draw them and describe their…
A: Carbohydrates chemically are polyhydroxy aldehydes or ketones. They serve diverse function roles…
Q: True or false 1. Heterogenous antibodies used for structural studies can be obtained by monoclonal…
A: Heterogenous antibodies - Heterogenous terms indicates that the molecule is a hybrid. i.e. a single…
Q: Eukaryotic RNA polymerase II resembles the prokaryotic RNA polymerase core. Which of the following…
A: Prokaryotes have only one RNA polymerase called prokaryotic RNA polymerase, but eukaryotes have…
Q: Draw the structure of the a-keto acid formed by the transamination of each amino acid: (a) tyrosine…
A: Transamination is a type of reaction in which, the amino group of an amino acid is transferred as a…
Q: 5. Ways of cholesterol biotransformation, their tissue localization: 5.1. extracellular (LCAT) and…
A: Sterols are lipids with the characteristic steroid nucleus. The steroid nucleus is four fused rings,…
Q: How many electron(s) is/are required to completely reduce an oxidized cytochrome-c
A: Electrons generated during the oxidation of carbohydrates are carried by electron carriers such as…
Q: What must happen first in order for dietary fats (triacylglycerols) to be digested? wandering AFTERS…
A: Fats (i.e. triacylglycerols) are hydrophobic. Once ingested, most of the fats reach the intestine…
Q: What is the concentration of the cough suppressant in parts per million?
A: Some solutes might be present in a solution in very little amount. So, the concentration of these…
Q: Cow's milk allergy (CMA) and lactose intolerance both result from dietary exposure to cow's milk and…
A: “Since you have posted multiple questions, we will provide the solution only to the first question…
Q: Question 15 The GroES subunit has 14 identical 549-residue subunits arranged in two stacked rings…
A: GroEL-ES is a molecular chaperone complex that assist in the folding of cellular proteins. The…
Q: The B-oxidation of the saturated 14-carbon fatty acid myristic acid yields the following NET amount…
A: In beta oxidation, large fatty acids that have been transformed into acyl-CoA chains are gradually…
Q: A drug with an elimination half-life of 1 hour was given to a male patient weighing 60 g by IV at…
A: Given, Rate of administration IV (R) is 300 mg/hr Plasma drug concentration at 7 hours was (C) 11…
Q: Calculate θ for a certain protein-ligand pair when the ligand concentration = 1 M and the Kd = 1 X…
A: The core of biology is molecular connections. Two molecules, such as a ligand and a receptor, must…
Q: Question 25 Proteins synthesized on free ribosomes are transported to which cellular destination? O…
A: As per the central dogma of molecular biology, the genetic information stored in the DNA is copied…
Q: 1) Tabulate the differences and/ or similarities of the different kinds of coenzymes and cofactors.…
A: "Since you have asked multiple questions, we will solve the first eight questions subparts for you.…
Q: Consider the equilibrium of arginine below: NH₂ NH₂ H₂N: 0 NH OH H₂NE pKa-2.17 NH3 NH H₂N: pKa 9.04…
A: The proteins are constituted of 20 naturally occurring amino acids. The net charge on an amino acid…
Q: Question 16 Proteins imported into the nucleus are transported via which mechanism? tranlocational…
A: The proteins are constituted of twenty naturally occurring amino acids. The proteins have signal…
Q: Which energy system did you use for a vertical one-clap pushup or pushup? (Choose one) A) ATP-PC…
A: Answer ATP-PC system Explanation The ATP-PC system, also known as the phosphagen system, is the…
Q: Paper electrophoresis of Asn, Ala, Asp, Lys and Ser mixtures at pH = 7 shows the fastest movement…
A: Since you have posted multiple questions, we will provide the solutiononly to the first question as…
Q: These enzymes form covalent intermediates A. Papain B. Alkaline phosphatase C. Elastase D. All of…
A: Enzymes are biological catalysts that increases the rate of the reaction. They do so by having a…
Q: What is the function of uncoupling proteins in hibernating mammals? ○ A) They allow protons…
A: Uncoupling protein 1 or UCP1 (thermogenin) and is important in helping animals keep warm during the…
Q: The number of calories used during physical exercise is greater than the number of calories used for…
A: “Since you have posted a question with multiple sub parts, we will provide the solution only to the…
Q: 4 Using the structures you drew in questions 2 & 3, for each of the organic functional groups listed…
A: The structures of the compounds from questions 2 and 3 are given below (lecithin) The…
Q: Explain the role of carnitine in the energy supply of the myocardium
A: Carnitine plays an important in heart's metabolism. It's responsible for transporting fatty acids,…
Q: 1. Hydrolysis of 1 M glucose 6-phosphate catalyzed by glucose 6-phosphatase is 99% complete at…
A: Standards free energy change calculated at biochemical standards is called biochemical standard free…
Q: The aromatic side chain of Trp residues in proteins and peptides can be chemically modified by two…
A: Amino acids are classified as acidic, basic, hydrophobic and polar neutral based on the nature of…
Q: Enzymes are essential to the processes of photosynthesis and cellular respiration. Names two factors…
A: Enzymes are high molecular-weight protein molecules that catalyse biochemical reactions. The…
Q: Students carry out a laboratory experiment with avidin (a protein in eg white) having a very high…
A: Enzymes are proteins that catalyse biochemical reactions. Sometimes enzymes require a non-protein…
Q: Focusing on the mechanism linking complex I and ATP synthase depicted in figure 3 in the article,…
A: Peter Mitchell in t the chemiosmotic theory proposed that there exists a membrane localized,…
Q: An aminoacyl-tRNA is initially bound to the ribosome in prokaryote at the A site on the 70S subunit…
A: A small RNA molecule known as transfer RNA (tRNA) is essential for the production of proteins.…
Q: What is the abbreviated name of the human gene that contains the CAGATTGTGAAGAGGTCTCTTGA? following…
A: Nowadays there are various tools that are used in bioinformatics to find out the gene from the gene…
Q: (c) Outline how you would investigate whether BCMAP would be an effective inhibitor for the protein…
A: Inhibitors are the molecules that slow down or completely block the protein activity of molecules,…
Q: How much 6x loading dye should be added to 49 uL of DNA? Report you answer in units of uL, with one…
A: The equation of dilution: M1xV1 = M2xV2 Where, M1 is the molar concentration of the stock solution.…
Q: Assess the role of redox electron transfer in the formation of an electrochemical proton gradient…
A: Aerobic catabolism of 1 molecule of glucose can produce 10 NADH (6 from acetyl CoA in the TCA cycle…
Q: Given the Lewis structure below: HO H H C C C C CIH There are sigma bonds and pi bonds.
A: Sigma and pi bonds are types of covalent bonds that differ in the overlapping of atomic…
Q: Question 22 Each GroEL subunit has an ATP-binding pocket that catalyzes hydrolysis of its bound ATP…
A: GroEL-ES is a molecular chaperone complex assit in folding of cellular proteins. GroEL is composed…
Q: Provide a simple sketch of the covalent intermediate likely to form between active site serine…
A: Serine, histidine, and aspartate all are amino acids. They all have different properties and…
Step by step
Solved in 3 steps with 2 images
- The peptide aspartyl-glutamyl-leucyl-threonyl-alanine, shown in the sketch drawing window, has several ionizable groups. Adjust the charges to show the molecule as it would exist at pH 5.00. Use the pk values in the table below. pK, Values for Ionizable Groups of Amino Acids. Amino Acid pA, of a-COOH pA, of e-NH, pA, of Side Chain Isoelectric Point (pI) Alanine 235 9.87 6.11 Arginine 2.01 9.04 12.48 10.76 Asparagine 2.02 8.80 5.41 Aspartic acid 210 9.82 3.86 298 Cysteine 2.05 10.25 8.00 5.02 Glutzmic acid 2.10 9.47 4.07 3.08 Glutamine 217 9.13 5.65 Glycine 235 9.78 6.06 Histidine 7.11 9.18 6.10 7.64 Isoleucine 232 9.76 6.04 Leucine 233 9.74 6.04 Lysine 218 8.95 10.53 9.74 Methionine 2 28 9.21 5.74 Phenylalanine 2 58 9.24 5.91 Proline 2.00 10.60 6.30 Serine 221 9.15 5.68 Threonine 2.09 9.10 5.60 Trуptophan 238 9.39 5.88 Tyrosine 2 20 9.11 10.07 5.63 Valine 2 29 9.72 6.00 • Use the wedge hash bond tools to indicate stereochemistry where it exists. • If a group is 2chiral, do not use…(a) A decapeptide has the following amino acid composition: Alaz, Arg, Cys, Glu, Gly, Leu, Lys, Phe, Val Partial hydrolysis yields the following tripeptides: Cys-Glu-Leu + Gly-Arg-Cys + Leu-Ala-Ala+ Lys-Val-Phe + Val-Phe-Gly. Reaction of the decapeptide with 2,4-dinitrofluorobenzene yields 2,4-dinitrophenylysine om the experimental data, deduce the primary structure of the decapeptide.1. For the following trisaccharide: a. Provide the abbreviated name b. Draw the chemical structure using Haworth projections c. Identify the trisaccharide as reducing or nonreducing. Label the nonreducing and reducing ends (if present) of the molecule. O-B-D-N-acetylgalactofuranosyl-(1>4)-a-D-mannopyranosyl-(1>6)-D-3-deoxyglucopyranose
- 1. Draw an approximate titration curve of the following amino acid. Label the approximate isoelectric point of arginine on the curve and be sure to label the axis of the graph appropriately. You DO NOT need to draw the structure of this amino acid here. Pk1= 1.92, pk2=8.99 and pk3=12.48. Show your work for determining the isoelectric point. You can draw out your curve within the text box or upload a drawing. A▾ B I - I B 7Given the following information about amino acid tyrosine answer questions 1 & 2: A. O H HO OH HO HO рказ 10.1 H NH₂ CH₂OH A. NH3 С. НО 1. Which of the above forms of tyrosine will be predominant in a solution with pH 9.5? 2. Which of the above forms of tyrosine is a cation? Answers to Questions 3 & 4 should be selected from the following choices: CH₂OH Holl O OH B. NH₂ pka2 9.01 conj acid OH В. НО "OH D. HO HO H OH pka1 2.2 O H -OH CH₂OH C. NH3 HO NH₂ O HO OH D. 3. Which of the monosaccharides above is a non-reducing sugar? 4. Which of the monosaccharides above is an aldotetrose? 5. What is the main functional group in a protein? ||||OH1. Amino acid analysis of the peptide gave the following residues: Asp Leu Lys Met Phe Tyr. The following facts were observed: Trypsin treatment had no effect. The phenylthiohydantoin released by Edman degradation was C-C-CH2. Brief chymotrypsin treatment yielded several products including a dipeptide and a tetrapeptide. The tetrapeptide contained Leu, Lys and Met is some order. Cyanogen bromide treatment afforded a dipeptide, a tetrapeptide and a free Lys. What is the amino acid sequence for this heptapeptide?
- Make use of the table below in answering the questions asked: Amino acid pK₁ pK₂ pK, Isoleucine 2.32 9.76 Leucine 2.32 9.74 Lysine 2.16 9.06 10.54 Tyrosine 2.20 9.21 10.46 1. Kindly draw manually the structure of tripeptic ILY at pH 7.00 2. Kindly draw manually the most protonated structure of tripeptide ILYTo calculate the isoelectric point of amino acids having other ionizable functional groups, we must also take into account the pk, of the additional functional group in the side chain. For an acidic amino acid (one with an additional acidic OH group): For a basic amino acid (one with an aditional basic NH group): pK, (a-COOH) + pK, (second COOH) - pKa (a-NH3") + pK, (side chain NH) pl = a. Indicate which pK, values must be used to calculate the pl of each of the following amino acids: [1] glutamic acid; [2] lysine; [3] arginine. b. In general, how does the pl of an acidic amino acid compare to that of a neutral amino acid? c. In general, how does the pl of a basic amino acid compare to the pl of a neutral amino acid?1.Ala-Phe-Lys-Val-Val-Glu From the above polypeptide, what amino acid/s go/goes inside the cell after the following treatment: Chemotrypsin, thermolysin, then finally pepsin. What protein is left undigested? Write the primary structure of the undigested protein? 2.K-V-F-W-P-L-A-Y a.Chemotrypsin treatment b.Trypsin treatment c.Pepsin treatment d.Thermolysin treatment 3.Total acid hydrolysis of a pentapeptide complemented by total alkalinehydrolysis yields an equimolar mixture of 5 amino acids listed alphabetically, ala-cys,lys,phe,ser. N-terminal analysis with phenylisothiocyanate (PITC) generate PTH-ser. Trypsin digestion produces a tripeptide where N-terminal residue is cys and a dipeptide with ser as its N- terminal.Chemotrypsin digestion of the above tripeptide yields ala plus another dipeptide. A.What is the amino acid sequence of the tripeptide B.What is the amino acid sequence of the dipeptide derived from trypsin digestion? C.What is the primary structure of the original…
- 1. What will happen if there is a change in the configuration of a protein molecule? Provide an example. 2. Give the IUPAC name for Ala-Gly-LeuOne or more of the compounds shown below will satisfy each of the following statements. Not all compounds may be used; some may be used twice. Put the number(s) in the blank. (1) Found in chitin. (2) An L-saccharide. (3) The first residue attached to asparagine in N-linked glycans. (4) A uronic acid. (5) A ketose. CH,OH CoO COO OH H H H H ОН Н но OH OH H OH H HO OH H NHC- CH, Oso, OH (a) (b) (c) CH,OH CH,OH CH,OH C=0 CHOH C=0 H-C- OH CH,OH но -с-н ČH,OH CH,OH (d) (e)Draw the following amino acids interactions: 1. H-bond - between -0H of Serine amino acid and C=0 backbone of glutamic acid. 2. Ionic bond- between ionized aspartic and asparagine amino acids. 3. Disulfide interaction between 2 molecules of Cysteine amino acids. 4. Hydrophobic interaction between Alanine and Leucine R-groups.