Answered: Fat soluble substance diffuse through…

Fat soluble substance diffuse through the following regions of the selectively permeable cell membrane O a Phospholipid Heads Ob Phospholipid Tails O c. Proteins Od A and C Oe. All of the Above

BIOLOGY:CONCEPTS+APPL.(LOOSELEAF)

10th Edition

ISBN:9781305967359

Author:STARR

Publisher:STARR

Chapter4: Cell Structure

Section: Chapter Questions

Problem 4SA: Cell membranes consists mainly of ________ and ________ . a. lipids; carbohydrates c. lipids;...

See similar textbooks

Related questions

Q: Read the scenario. A botanist (a biologist who specializes in plant biology) is researching the…

A: In order to determine if the plant she discovered are of the same species or different species, a…

Q: What type of epithelium lines the gastro-intestinal tract? O Transitional O Simple columnar O…

A: The epithelium is a type of body tissue that is widespread throughout the body and covers all the…

Q: 1. Living vertebrates share a set of derived characters that distinguish them from other How does…

A: Homeobox group of genes are important transcription factors that are essential for embryonic…

Q: Explain the neutralist versus selectionist debate. What patterns are expected from each? What data…

A: Explanation: The argument between neutralists and selectionists refers to the controversy among…

Q: Because plants do not have skeletons, what accounts for their rigidity?

A: Plants These are eukaryotic organisms that have the ability to produce their own food through the…

Q: Provide a summarizing paragraph of the process of translation (no more than 6 lines)

A: Translation is a process by which our cells synthesize proteins. And it's the part of central dogma…

Q: Your graphs should have helped you learn about relationship between size and respiration; what is…

A: Respiration The process of respiration takes place in the mitochondria of the cell.

Q: The ECG records the electrical stimulation of cardiac muscle by the conduction system and not the…

A: We know that Electrocardiogram (ECG) is used to measure the changes in the electrocardiograph. One…

Q: INSTRUCTION: Answer the question properly Do not copy in Google, plagiarize checker will be used.…

A: The bacterial species are classified according to the characteristics of their cell wall. The…

Q: Which of these statements are false for lichens? Please select all correct answers. a.) Fungal…

A: In phytosociology and community biology, an association is a form of ecological community that grows…

Q: Describe vesicle trafficking process.

A: The cells of our body are made up of many organelles and each one has its specific role to perform.…

Q: When a pseudoscorpion hitches a ride on a large arthropod, what does the larger arthropod gain from…

A: This is a type of commensal interaction that is known as phoresy. Commensalism is an interaction in…

Q: The following is the function of the cell membrane proteins: O a. Channels O b. Receptors O c.…

A: Introduction All cells have a cell membrane, also known as a plasma membrane, which separates the…

Q: look at the screenshot please

A: A Series of events from the formation of a cell, followed by growth and division to produce new…

Q: After maintenance is performed on the chemistry instrument electrolyte ISE testing, the laboratories…

A: Explanation: Option a: This option is incorrect because hyponatremia is a condition that results…

Q: used

A: C) Measure how much oxygen is used

Q: 14 15 16 17 18 19 Which of the following examples could help reduce competition between two species?…

A: Competitive exclusion can easily be avoided if one or both of the species that are competing-…

Q: When researchers do IVF in the mouse, they collect sperm from the epididymis. Can they directly put…

A: IVF In vitro fertilization is the type of fertilization in which sperm and egg fusion takes place…

Q: 13) Use the image below of the X and Y sex chromosomes of a human to answer the following question.…

A: INTRODUCTION : Chromosomes - In the nucleus of every cell, the DNA molecule is packaged into…

Q: What are the Equality in the Sexes in Human Evolution? Why is this important to learn?

A: Evolution It refers to the alteration in the inheritable traits of biological populations over…

Q: why would a cell invest ATP to move particles using active transport?

A: Materials must be moved against a concentration or electrochemical gradient, which requires the cell…

Q: A. Produces somatic cells B.Genetically distinct from each other. C.Four haploid cells…

A: There are two types of cell division, such as mitosis (2n) and meiosis (n). In mitosis ,the daughter…

Q: I need help with the diagrams for aHypertonic, Isotonic, Hypotonic, Solute

A: Tonicity is a property that can make the volume of the cells altered with the water content. The…

Q: D In the following DNA strand, find the position of the start codon, stop codon and determine the…

A: The given DNA strand - GGTACTTTATACCCTGATACATTTGTGGGG Corresponding mRNA strand -…

Q: the following are the hydrophobic regions of a selectively permeable cell membrane: O a Phospholipid…

A: Cell membrane is made of phospholipids majorly. These phospholipids consists of double layered…

Q: Explain the role receptor-mediated endocytosis (RME) plays in virus replication (lytic cycle).

A: The plasma membrane is made up of phospholipids, proteins, and carbohydrates. Only some molecules…

Q: QUESTION 17 How many peptide bonds in the structure below? 357 00 3 07 CH₂ white 8 9 QUESTION 18 How…

A: Proteins are a class of complex nitrogenous organic compounds composed of amino acid residuous join…

Q: what prevents the dominant follicles of Waves 1 and 2 from ovulating? a. follicles are not big…

A: The formation of the follicle that houses the egg takes place during the follicular phase at the…

Q: The following is the location of the cell membrane proteins: O a. Some only face the extracellular…

A: Cell membrane The living semi permeable membrane that is selectively permeable and allow both…

Q: Explain how phylogenetic trees are interpreted and created. Explain what types of traits are used…

A: Explanation: A phylogenetic tree is a graphical depiction of the evolutionary connections between…

Q: XL 10 Gold cells and Express I^q cells. Give three differences between their genotypes and how each…

A: The XL10-Gold ultracompetent cells were designed for cloning large plasmids and ligated DNA with the…

Q: What would you need to do to preform a successful PCR but only had thermolabile DNA polymerase? Can…

A: Polymerase chain reaction(in - vitro) technique is used for amplifying defined sequences of target…

Q: Part The relationship between the breakdown of macromolecules and the biosynthesis of macromolecules…

A: Ans: Food provide us the fat, protein, carbohydrates that give the body to building blocks to…

Q: 8. A 60 kg individual needs to work at a MET level of 8 to reach her target heart rate. If the…

A: The grading and the intensity for the question is solved below in the pic :-

Q: Label the bone, process, or tissue in the image below: ABCD A. B. B D C

A: Introduction :- The skeleton of the body is made up of bone, which is living tissue. Bone tissue…

Q: Use the concept of sensory adaptation to explain how sensory adaptation occurs for either the sense…

A: INTRODUCTION : Sensory adaptation - It is a reduction in sensitivity/reaction to a stimulus after…

Q: What is the difference between howler monkeys and wooly monkeys? Are there any visual differences?

A: Introduction The most advanced placental mammals are the primates. Primates are mammals that lead an…

Q: List and briefly explain the three types of blood vessels in the body.

A: Blood is carried throughout our body through some closed channels known as blood vessels. Blood…

Q: During which phase of cellular respiration is oxygen used?

A: Cellular respiration is the process by which biological fuels are oxidised in the presence of an…

Q: In a neuron, the conducting regions of the capacitor are represented by the intracellular and…

A: Neurons (also called neurones or nerve cells) are the fundamental units of the brain and nervous…

Q: ¹C2²2S + E Sk3,0 where S is a T-cell of a particular variety, E is the corresponding (free, i.e.…

A: T cell, also called T lymphocyte, type of leukocyte (white blood cell) that is an essential part of…

Q: 86. transport of molecules across a selectively permeable membrane requires the input of energy from…

A: The cell membrane is a semi-permeable phospholipid bilayer, that allows only small molecules, gases,…

Q: The ECG records the electrical stimulation of cardiac muscle by the conduction system and not the…

A: Introduction The thick middle layer of the cardiac is made up of cardiac muscle or myocardium.…

Q: Label the bone, process, or tissue in the image below: ABCD A. B D

A: We know that The respiratory system consists of the nose, the pharynx, the larynx, the trachea, the…

Q: . How sure would we be that he is not a carrier if all the calves are born normal? How many would…

A: Curly calf syndrome is a genetic disorder that is lethal for the calf. It is seen in beef cattle and…

Q: what is the difference between a ligand and a domain? I understand they both attach with proteins…

A: Ligand Domain A ligand is a chemical substance that are released in order to induce or transmit a…

Q: In a cross of 2 plants, one with red flowers and round leaves and the other with blue flowers and…

Q: Which of the following is not true regarding cytokinesis?* A.Simultaneously happen with the…

Q: What is the term used to describe the state of an axon in the later phase of an action potential…

A: Introduction A cell location's membrane potential experiences an action potential when it rapidly…

Concept explainers

Osmosis

In simple words, osmosis is the slow, gradual movement of a liquid through a membrane. But there are nuances to this process. For instance, there has to be an imbalance in the distribution of solute in the liquid on either side of the membrane, which has to be semipermeable. The liquid in the region with a lower solute concentration moves to the region with a higher concentration, thereby displacing the solution in the process. The objective is to equalize the concentration of molecules on both sides of the membrane; the displacement of liquid can be viewed as a byproduct of this equalization. Since there is no energy required to carry osmosis, it is considered a passive process.

Question

Fat soluble substance diffuse through the following regions of the selectively permeable cell membrane:
O a Phospholipid Heads
Ob Phospholipid Tails
O c. Proteins
Od A and C
Oe. All of the Above

Expert Solution

This question has been solved!

Explore an expertly crafted, step-by-step solution for a thorough understanding of key concepts.

This is a popular solution!

SEE SOLUTION Check out a sample Q&A here

Step 1

VIEW

Step 2

VIEW

Trending now

This is a popular solution!

Step by step

Solved in 2 steps with 2 images

SEE SOLUTION Check out a sample Q&A here

Knowledge Booster

Learn more about

Need a deep-dive on the concept behind this application? Look no further. Learn more about this topic, biology and related others by exploring similar questions and additional content below.

Similar questions

Which of the following methods of transport is being used to transfer the substance into the cell in the accompanying graph? a. diffusion down a concentration gradient b. osmosis c. facilitated diffusion d. active transport e. vesicular transport f. It is impossible to tell with the information provided.
Cell membranes consists mainly of ________ and ________ . a. lipids; carbohydrates c. lipids; phospholipids b. phospholipids; protein d. phospholipids; ECM
Which plasma membrane component can be either found on its surface or embedded in the membrane structure? a. protein b. cholesterol c. carbohydrate d. phospholipid
In the fluid mosaic model: plasma membrane proteins orient their hydrophilic sides toward the internal bilayer. phospholipids often flip-flop between the inner and outer layers. the mosaic refers to proteins attached to the underlying cytoskeleton. the fluid refers to the phospholipid bilayer. the mosaic refers to the symmetry of the internal membrane proteins and sterols.
Water soluble substances diffuse through the following regions of the selectively permeable cell membrane O a Phospholipid Heads Ob Phospholipid Tails Oc Proteins Od A and C Oe. Al of the Above
What major type of molecule contributes to the formation of the cell membrane and what biochemical properties of this molecule promotes the formation of the membrane? What effect allows this type of molecule to come together to form a bilayer and explain how the effect works? A▾ B I I e 2 2
According to the fluid mosaic model, integral membrane proteins Select one: O A. undergo frequent flip flop movement OB. are free to leave the membrane O C. none of the choices O D. are embedded in the phospholipid bilayer O E. may attach to cholesterol Next page
the structure of the plasma membrane is best described as: two layers of phospholipids stacked on top of each other, with proteins embedded in the phospholipids Oa single layer of proteins and polysachharides mixed together two layers of proteins stacked on top of each other O many sheets of peptidoglycan stacked on top of each other O one layer of triglycerides on top of a layer of proteins
3. Identify the component parts of the plasma membrane shown in Figure 1.770 outside cell cytosol Figure 1 (b) NEL good as e oc (d) (e) 88 f $8 88/0008 Booo %1000 d lipid bilayer C STUDY Complex At first a confusing and relab help you parts. Afte the diagra complica 2.2 Membrane Struc
According to the fluid mosaic model, integral membrane proteins Select one: O A. none of the choices O B. are free to leave the membrane O C. undergo frequent flip flop movement O D. may attach to cholesterol O E. are embedded in the phospholipid bilayer
The average concentration of salt in seawater is about 3.5 percent and the average concen- tration of salt in the human cellular environment is about 0.9 percent. Drinking seawater can be fatally harmful and is highly discouraged even in the most severe cases of dehydration. Which of the following provides the most likely cause for this fact? A B с D The increase in salt concentration in the extracellular environment will increase the per- meability of the cell membrane. The increase in salt concentration in the extracellular environment will cause the move- ment of water into the cell. The increase in salt concentration in the extracellular environment will cause the move- ment of water out of the cell. The increase in salt concentration in the extracellular environment will decrease the per- meability of the cell membrane.
A protein with a domain inside the hydrophobic plasma membrane and a hydrophilic domain inside of the cell is likely what kind of protein? Integral Peripheral O Anchored O Terminal O None of the above DUESTION 29