Formation of a GC-rich stem-loop in the mRNA is required for function of an intrinsic transcription terminator in bacteria. True False
Q: he write a conclusion and if the hypothesis was (rejected, modified, or supported) Questions: 1.…
A: Enzyme assays are laboratory tests undertaken to figure out the kinetics of an enzyme catalyzed…
Q: Using an arrow, draw the site of cleavage for the following peptides that are reacted by: Pepsin…
A: Amino acids are building blocks of peptides and polypeptide chain. Peptides are consist of 2-50…
Q: Briefly describe the role of glycoproteins as antigenic determinants for blood groups.
A: Glycoproteins are proteins with carbohydrates attached to it. The carbohydrates that are commonly…
Q: What would be the standard free energy change if FADH 2 is used to reduce O 2 to water? Standard…
A: Biological oxidation-reduction reactions involve the transfer of electrons from one biomolecule,…
Q: 27. While culturing some cells, you lower the temperature of the culture. What happens immediately…
A: Cell membrane are composed of lipid bilayer and proteins. Membrane fluidity depends on the content…
Q: Given the following reaction below, what amino acid is involved and what is the specific reaction…
A: Phenylalanine, tyrosine, and tryptophan are aromatic amino acids. The side chain of the…
Q: What is the product of the oxidation of this fatty acid?
A: Fatty acids are carboxylic acids with a hydrocarbon chain ranging from 4 carbon to 36 carbons.…
Q: 12. The graph shows values of arterial plasma bicarbonate concentration and pH for different persons…
A: Metabolic alkalosis is caused by acid base imbalance in the blood. It is characterised by increase…
Q: 018 You have isolated a gene that spans a total of 1800 nucleotides. The gene contains 400…
A: Genes are the sequences of nucleotides attached together through phosphodiester bonds. Genes are…
Q: Which of the different carbohydrate tests would give a positive result for maltose? Describe the…
A: Maltose is a disaccharide composed of 2 D-glucose molecules. The bonding pattern is α-1,4 . Hence…
Q: H₂C-O-C-(CH₂) 16CH3 i HC-0- H₂C-O-C-(CH₂) 14CH3 (a) -(CH₂)7CH=CH(CH₂)7CH3 H₂C-O-C-(CH₂) 14CH3 요…
A: Fats and oils are triglycerides or triacylcylgerols. They are esters which three fatty acid are…
Q: H3C CH3 -(HC- H₂ H₂ -C-C -CH2)3- Pristanic acid CH3 IL.
A: Pristanic acid is a branched chain fatty acid . It is 2,6,10,14 tetra methyl Penta decanoic acid.…
Q: Explain the role that Gla residues play in complexes. Explain the role of vitamin K / warfarins in…
A: Blood coagulation is a complex process where many factors are involved. This factors can be…
Q: What volume of a 0.8 M glucose solution can be made from 50 mL of a 2M stock solution?
A: Stock solution is the given solution present in lab. From the stock solution, we make the working…
Q: Which of the following is NOT a naturally-occurring amino acid? A) B) C) D) H₂NCH-COO CH3 H₂NCH-COO…
A: The proteins are composed of twenty naturally occurring amino acids. These amino acids are alpha…
Q: Identify three enzymes and the scientists who worked on them. What are the importance of these…
A: Enzymes are highly specialized proteins that have extraordinary catalytic power, greater than that…
Q: 8. Why is it important to maintain blood glucose during exercise? How is this achieved?
A: During exercise, it is important to maintain glucose homeostasis. There is a tight regulatory…
Q: When doing automated sequencing, on the other hand, all 4 dideoxynucleotides are added to the same…
A: The genetic information is encoded in the sequence of DNA that is the genetic material. The Sanger…
Q: What is the purpose of using a strong acid in the Seliwanoff’s test
A: Carbohydrates are polyhydroxy aldehydes or ketones or biomolecules that yield polyhydroxy aldehydes…
Q: Using an arrow, draw the site of cleavage for the following peptides that are reacted by: Pepsin…
A: Amino acids are building blocks of peptides and polypeptide chain. Peptides are consist of 2-50…
Q: 1. Identify the encircled functional group (hydroxyl, carbonyl, amino, carboxyl). a) H3C. H3C S N NH…
A: There are four major classes of biological macromolecules called Nucleic Acids, Proteins,…
Q: diabetic patient has a sodium concentration of 141 mmol/L, a glucose concentration of 742 mg/dL and…
A: Osmosis is the movement of water across the semipermeable membrane driven by the difference in…
Q: Question 9 Which of the following fatty acid does have greater solubility in wat O 16:0 O 18:0 O…
A: Fatty acids are a class of lipids that are nonpolar and are insoluble in water. The naturally…
Q: The mitochondrial matrix is home for the following: I. ribosomes II. circular DNA III. Kreb's…
A: Mitochondria is a membrane bound organelle which is also known as power house of the cell as it is…
Q: n which of the test tubes would you say hydrolysis has taken place in this experiment? Why?
A: Enzymes are large molecular weight proteins that catalyse biochemical reactions. The substrate bind…
Q: Calculate for the initial pH, final pH, and buffer capacity if 0.1 mole of H+ is added to 1L of…
A: The reaction that would take place when we add H+ (here H+ is the acid added) into the given buffer…
Q: Review the following statements and discuss whether each one is correct, incorrect or partially…
A: Glycolysis is a major metabolic pathway in which glucose is breaken down to pyruvate and forming ATP…
Q: 384 Hemoglobin: Allostery and Evolution Q5.1 - 2,3-BPG is a negative allosteric regulator of…
A: Hemoglobin (Hb) is a protein that is found in red blood cells. A specific protein called haemoglobin…
Q: Which of the following would you expect to happen if amino acids 579 to 582 (YIYV) in the PDGF-Beta…
A: PGDF beta-receptor contain multiple domains that activate the various pathways inside the cell. The…
Q: Only 0.1% of peptide bonds have the cis configuration. Calculate the difference in energy between a…
A: A peptide bond is formed between the alpha carboxyl group of the amino acid residue at the N…
Q: 5) Both DNA polymerase (any DNA polymerase) and ligase catalyze the formation of a bond between…
A: DNA Polymerase and Ligase are the two classes of enzymes that take part in DNA replication and…
Q: Since myoglobin is red and it may interfere with the absorbance of Bradford Protein Assay at…
A: Bradford protein assay is performed to measure the amount of protein in an unknown sample. Coomassie…
Q: Your supervisor asks to make 350 mL of a 0.75% (w/v) starch solution using a 5% (w/v) stock…
A: Given Values: Concentration of the starch stock solution = 5 % The volume of the final starch…
Q: (a) (b) (c) The figure shown below is the mechanism of a DNA nuclease. The DNA molecule is in blue…
A: The given figure shows the mechanism of a DNA nuclease. Nucleases breaks the phosphodiester bonds of…
Q: Which of the following statements is FALSE regarding oxidative phosphorylation? The pH is higher in…
A: Cellular respiration is a collection of three metabolic pathways that generate ATP by oxidation of…
Q: Qualitative Color Reactions Color Reaction Biuret Ninhydrin Xanthoproteic Millon's Intact Protein…
A: Hi! Thank you for the question. We are authorized to answer four subparts at a time, since you have…
Q: Explain how important is biochemistry to you as a nursing student, and how can it help you?
A: The study of the makeup and operation of biological molecules such nucleic acids, proteins, and…
Q: For the questions below be sure to show your work as well as the answer to the question. In this…
A: Hi! Thank you for the question. We are authorized to answer five subparts at a time, since you have…
Q: Can you help with 1a please HELPFUL INFORMATION: When performing classical Sanger or "dideoxy"…
A: Sanger sequencing is done to identify the sequence of DNA. In this process, a particular ddNTP is…
Q: The overall process of glycolysis converts a C6 molecule into: O A different C6 molecule O Three C2…
A: Glycolysis is the catabolic pathway and is the first step of cellular respiration that takes place…
Q: The acetyl group shuttle transfers the acetyl group of acetyl-CoA, produced by oxidative…
A: Acetyl CoA is produced in mitochondria and cannot leave mitochondria so it combines with…
Q: What do x-helices and B-sheets have in common?
A: Alpha helix and beta sheets are two types of secondary structure present in the protein structure.…
Q: What are the extinction coefficient of Myoglobin (Equine) at 280 nm and 410 nm respectively?
A: Myoglobin is a conjugated protein that contains heme conjugated to globin chain. Myoglobin contains…
Q: If a liver extract capable of carrying out normal metabolic reactions (including gluconeogenesis) is…
A: Gluconeogenesis is the metabolic pathway that converts non-carbohydrate metabolites like pyruvate…
Q: Since higher concentration colcemid will result in shorter chromosome, you want to change your…
A: It is given that: Molar concentration of the stock solution: 10 ug/ml. Desired dilution…
Q: His-Met-Asp-Tyr-Phe-Ser Calculate an approximate pI (isoelectric point) for this peptide. Please use…
A: Recall that: Amino acid sequences are written with N-terminal amino acid on the left and C-terminal…
Q: 6. What term is used to describe reactions that generate metabolic intermediates of a pathway? A.…
A: The reactions that generate metabolic intermediates of a pathway is termed as - Answer- B.…
Q: Pyruvate can be converted to glucose via gluconeogenesis, or it can be oxidized to acetyl-CoA for…
A: Glycolysis is the collection of 10 enzymatically catalysed reactions that oxidises a 1 molecule of…
Q: 1) What is the full name of the following molecule? 2) Briefly explain the functions of this…
A: The biochemistry of cells is greatly influenced by a variety of biological components. These…
Q: of the gluconeogenesis wing is not true? A. Phosphofructokinase-1 (PFK-1) and…
A: Glycolysis - is a process in which one mole of glucose is partially oxidized into two moles of…
Step by step
Solved in 2 steps
- Which of the following is/are typically removed from pre-mRNA during nuclear processing in eukaryotes? (a) upstream leader sequences (b) poly-A tail (c) introns (d) exons (e) all the precedingRNA silencing can be accomplished by specific MRNA degradation or by preventing its translation of the encoded protein. What specifically determines which of these two pathways will be followed? OIt depends on whether Drosha is involved in the process. It depends on whether Dicer is associated with single- or double-stranded RNA. It depends on whether the single-stranded RNA, associated with RISC, base-pairs perfectly or imperfectly with the target mRNA. It depends on whether the RITS or the RISC complex associates with double-stranded RNA. It depends on whether RISC initially binds to single- or double-stranded RNA. OOOWhat is the mechanism for addition of a guanosine to create the 5' methyl cap of a mRNA? O The 5'-OH end of the nascent mRNA performs a nucleophilic attack on the gamma phosphate of GTP O The gamma phosphate is removed from the 3' end of the nascent MRNA and then the beta-phosphate attacks the phosphorus atom of the alpha- phosphate of GTP O The gamma phosphate is removed from the 5' end of the nascent mRNA and then the -OH group from the beta-phosphate attacks the phosphorus atom of the alpha- phosphate of GTP O The 5'-OH end of the beta phosphate present on nascent mRNA performs a nucleophilic attack on the alpha-phosphate of GTP
- RNA silencing can be accomplished by specific mRNA degradation or by preventing its translation of the encoded protein. What specific determines which of these two pathways will be followed? It depends on whether the RITS or the RISC complex associates with double-stranded RNA. It depends on whether the single-stranded RNA, associated with RISC, base-pairs perfectly or imperfectly with the target mRNA. It depends on whether Drosha is involved in the process. It depends on whether Dicer is associated with single- or double-stranded RNA. It depends on whether RISC initially binds to single- or double-stranded RNA.Hemophilia in the Russian royal family was caused by defective protein involved in blood clotting (factor IX). This defective protein was caused by a mutation that altered the splicing of the exons. This genetic change in the splicing pattern created a new stop codon in the mRNA for factor IX. Give an example of how a mutation that altered the splicing sites in the pre-mRNA might lead to a premature stop codon in the gene.Consider the following sequence fragment of an mRNA. Which of the miRNAS below would be competent for gene silencing? 5'-AUGCAAGCAUUGGCCAAGCUU-3' 5'-AUGCAAGCAUUGGCCAAGCUU-3 5'-UACGUUCGUAACCGGUUCGAA-3' 5'-AAGCUUGGUUAAUGCUUGCAU-3' 5'-UUCGAACCAAUUACGAACGUA-3' 3'-UUCGAACCAAUUACGAACGUA-5 3'-AUGCAAGCAUUGGCCAAGCUU-5'
- RNA silencing can be accomplished by specific MRNA degradation or by preventing its translation of the encoded protein. What specifically determines which of these two pathways will be followed? OIt depends on whether Drosha is involved in the process. OIt depends on whether Dicer is associated with single- or double-stranded RNA It depends on whether the single-stranded RNA, associated with RISC, base-pairs perfectly or imperfectly with the target MRNA. It depends on whether the RITS or the RISC complex associates with double-stranded RNA. It depends on whether RISC Initially binds to single- or double-stranded RNA.The following is the only intron sequence of a gene that will be excised during the maturation of the mRNA. But it is not spliced in some tissues, where alternative splicing pattern is seen. Will the amino acid of its protein product following this sequence change? Explain with an example. ATGATAGCCAGACTCGCAThe dlagram below represents the tryptophan operon with the trp leader MRNA transcript enlarged to represent the AUG transiation start codon, two consecutive tryptophan amino acld codons (UGGUGG), and 4 regions (1, 2, 3, and 4) that base pair to form different hairpin-loop structures in the MRNA leader region. What would happen in this MRNA leader region when cells encounter very low levels of tryptophan in Its environment? Leader region trpE trpD trpC trpB trpA DNA 5' 3' Transcription trp leader sequence mRNA UGGUGG (tryptophan codons) AUG UUUUUU 1 3 4. The translating ribosome would stall at the two tryptophan codons, causing the formation of a hairpin-loop botween regions 3 and 4 to promote transcription of the trp operon. The translating ribosome would stall at the two tryptophan codons causing formation of hairpin-loop between regions 2 and 3, which functions as an anti-lerminator of transcription The translating ribosome would stall at the two tryptophan codons causing formation…
- Gene X codes for a protein in eukaryotes. A mutated eukaryotic cell contains an altered base-pair in an intron of gene X. Which would be the most likely effect of this mutation on the biomolecules in the cell? The amount of pre-mRNA transcribed from gene X would be less than normal. The amount of functional protein corresponding to gene X would be less than normal. The ability of snRNAs to form a spliceosome would be diminished. The breakdown of mature mRNA corresponding to gene X would be fasterThe following is the only intron sequence of a gene that will be excised during the maturation of the mRNA. But it is not spliced in some tissues, where alternative splicing pattern is seen. Will the amino acid of its protein product following this sequence change? Explain with an example. ATAAGCCAGACTCAGCAThe following is the only intron sequence of a gene that will be excised during the maturation of the mRNA. But it is not spliced in some tissues, where alternative splicing pattern is seen. Will the amino acid of its protein product following this sequence change? Explain with an example. ATGATAGCACCAGACTCGCA