Q: The main tools the U.S. government provides that can help plan a healthy diet are __________. DRIs,…
A: A healthy diet includes a variety of nutrient-dense foods from all food groups, including fruits,…
Q: Bacteria can be used to produce human growth hormone (HGH-a peptide/protein) through genetic…
A: Human growth hormone is basically a peptide hormone.It is produced by anterior pituitary.It mainly…
Q: NH₂ 1 N= CH: A B C C-N 3-4 HC HICI I OH B HICIO с OH E HICIH -21 High-energy bonds 044 P-O G O-P-O-…
A: ATP stands for Adenosine triphosphate.It is the energy currency of the cell.It is considered as…
Q: I was told the correct answer is 0.006. Please advise why this one is diffrent
A: Introduction The fundamental piece of genetic information given from parent to child is the gene.…
Q: List 4 factors that increase O2 extraction to the tissues (muscles).
A: Exercise hyperemia is the term used to describe the increase in blood flow to the skeletal muscles…
Q: What is the arthropod's role in disease transmission such as malaria? Question 7 options: a)…
A: Arthropods, especially ticks and mosquitoes, are responsible for a number of parasitic and viral…
Q: Penicillium chrysogenum Morphology Picture attached. Description : 1. Conidium 2. Sterigmata 3.…
A: Penicillium notatum is a type of fungi.It comes under phylum ascomycetes.It can reproduce by all…
Q: 2. Fill in the labels on the following diagram that shows the light reactions of photosynthesis.
A: There are a few important points : We know that photosynthesis will take place in the green parts…
Q: Any break in the chain of infection prevents the spread of disease. Question 4 options: a)…
A: True.
Q: Filarid (microfilaria) parastites in lymphatics would most often cause which of the following…
A: A parasitic condition known as filariasis is brought on by an infection with roundworms of the…
Q: In the classic 1994 paper, "Does More Intensive Treatment of Acute Myocardial Infarction in the…
A: The passage is talking about the elderly patients who suffer from acute Myocardial Infarction which…
Q: Science Toolkit The Guilty Dentist hile biologists use the study of evolutionary relationships…
A: HIV stands for human immuno deficiency virus which is a retro virus responsible for causing AIDS. It…
Q: The gastrovascular cavity of cnidarians has two openings, one serves as mouth and the other serves…
A: Cnidaria is a phylum which is under kingdom Animalia that contains over 11,000 species of aquatic…
Q: Consider the cladogram shown. 1. Which pair of species shares the greatest number of derived…
A: Systematics tells about the relationship between taxons. Phylogenetic tree is given in the question.…
Q: What is the difference between coagulatiive and liquefactive necrosis? How are they related to…
A: Necrosis is referred to unprogrammed cell death due to a disease or an injury. It can affect many…
Q: draw the p21 promoter. Your drawing should include (1) the start site, (2) the TATA box and (3) the…
A: p21 protein: The p21 protein is a key protein that regulates the DNA repair process inside the…
Q: shirt (Sample A, n=83, Sample B, n = 19). Women at high conception risk were substantially more…
A: First let's try to understand these terms clearly:
Q: This is for an immunology class 1. Name of a type of host defense mechanism 2. One of the types…
A: Introduction: Immune system: an intricate system of organs, tissues, and the substances they produce…
Q: how many nucleotides are in CAGATTGTGAAGAGGTCTCTTGA consensus coding sequence? Answer in numerical…
A: Nucleotides are organic molecules made up of a phosphate and a nucleoside. They function as…
Q: What is a protozoan cyst? Discuss the importance of this structure in the ability of Giardia to…
A: Introduction:- Protozoa are one celled animals found worldwide in most habitats. They are…
Q: In a certain type of pea plant, the gene for yellow color (Y) is dominant to the gene for green…
A: Answer: Heterozygous : When the both alleles present are of different types (dominant allele and…
Q: _______ is the net movement of substances from a high concentration to a low concentration medium,…
A: Introduction: Diffusion is the overall net movement of anything from a higher concentration to a…
Q: Which chromosome does this gene CAGATTGTGAAGAGGTCTCTTGA, appear on in the human genome? Answerin…
A: Any gene can exists in two different forms, that are known as alleles. An allele of a gene has its…
Q: 4. In humans, brown eye color (B) is dominant to blue eye color (b). A woman who is homozygous…
A: An allele is one of two or more variations of a certain gene. A dominant allele can only show itself…
Q: 3. Why is rubisco considered to be the most important enzyme on earth? What does it do?
A: Introduction:- Ribulose-1,5-bisphosphate carboxylase/oxygenase, commonly known as rubisco is an…
Q: Which of the following groupings of the abdominopelvic regions is medial? a. Hypochondriac,…
A: The ability to correctly interpret an X-ray film is crucial for medical professionals in order to…
Q: Explain how the temperature of the human body is regulated
A: Maintaining constant bodily conditions is part of homeostasis. The stability of the environment is…
Q: Explain this statement "In a sense, the life cycle in the organism".
A: Understanding the life cycle of an organism can help us understand its behavior, ecology, and…
Q: Write the 3 short term effects and 3 long term effects in given classification of substance
A: Drugs are the substances which have physical or physiological effects on the body.Drugs are used to…
Q: Name the commonly used vector for cloning genes into higher organisms.
A: A vector is essentially a DNA molecule (typically like plasmids or viruses) utilised in molecular…
Q: A snapdragon plant with violet flowers was crossed with another such plant with white flowers. The…
A: INCOMPLETE DOMINANCE It is a gene interaction in which both alleles of a gene at a locus are…
Q: Identify a hormone from the anterior pituitary that is involved in ovum release and briefly describe…
A: The anterior pituitary, also known as the adenohypophysis, is a gland located at the base of the…
Q: explain how the skeletal, articular, and muscular systems work together to form the human skeletal…
A: Skeleton, articulates and muscles collectively forms musculoskeletal system also called as locomotor…
Q: When we measure species density. If you apply random sampling and systematic sampling to a site…
A: When we measure species density, we always choose the random sampling method as sampling method.…
Q: Flatworms show bilateral symmetry and some cephalization. True False Some parasitic…
A: Carl Linneaus form animal kingdom along with other 4 kingdom. Under animal kingdom, animals are…
Q: how many amino acids are in CAGATTGTGAAGAGGTCTCTTGA peptide sequence? Answer in numerical digits…
A: The DNA acts as the genetic element in most organisms. The genes are transcribed in mRNA. mRNA so…
Q: Considering the pandemic brought about by COVID-19, there has been plant-based products/ herbal…
A: Nowadays we are very familiar with the deadly virus Covid-19.It form pandemic in 2019-2021.This…
Q: You're trying to figure out the genotype of the mother based on the phenotypes of the offspring. Why…
A: Genetic constitution is referred to genotype and the appearance is referred to as phenotype.…
Q: presented in this MMWR article, explain the trends that were seen with giardia infection across the…
A: The trends seen with Giardia infection across the nation from 2011-2012 showed an overall decrease.…
Q: 2. If a cell has a large surface area:volume ratio will the movement of molecules in and out of the…
A: Cells are the units of life. Each cell has a definite shape and size. The newly formed cells are…
Q: A rectocele is a/an __________ of the rectum.
A: A rectocele is a/an ___prolapsed pelvic organ _______ of the rectum. So rectocele is a prolapsed…
Q: Per the book the answer to this questions is probability is 0.006.
A: The cross is between parents having genotype AaBb x Aabb. This genotype will produce four and two…
Q: With an example, explain how a change in an amino acid can change the structure of a protein.
A: The amino acid sequence of the protein is responsible for generating its 3D structure. A mutation in…
Q: What are the immunosensors used in the medical field? What are some examples of immunosensors? What…
A: Immunosensor are actually biosensor which is established on the theory of immune system where an…
Q: which of these is a/arepossible treatment option(s) for the disease(s) caused by mutations within…
A: A. Surgery - Surgery is a procedure that involves cutting of a patient's tissues or closure of a…
Q: Read the Guilty dentist information. Then use your understanding to answer the following question:…
A: The research contributes to a better knowledge of illnesses and other health issues, such as their…
Q: during the absolute refractory period k+ channels are open while na+ channels are 1. activated…
A: The phrase "refractory phase" refers to the period of time when a specific cell or organ is unable…
Q: 2. The Theory of Endosymbiosis states that: Plant cells are endosymbionts a. b. C. d. The…
A: Endosymbiosis is the theory of evolution of eukaryotes. Eukaryotes have a well partitioned cellular…
Q: Lipids most abundant form are Triglycerides building blocks are 1 If a triglyceride only contains…
A: Introduction:- Lipids and Proteins are categorised under bio-macromolecules. Proteins are higher…
Q: What is true about the geographic context of trees and keys? a. Neither phylogenetic trees nor…
A: Geographical context means that some organisms may not be distributed worldwide that is they may be…
Ee.35.
How do you make a 10x solution of 1M dextrose? What should be the volume and how many grams. (show your work)
Step by step
Solved in 2 steps
- 1. Given .750L of a 12M HCI solution, what volume of 5.00M HCI could you make?17. If an intravenous injection contains 20% (w/v) of mannitol, how many milliliters of the injection should be administered to provide a patient with 100 g of mannitol? 17. 500 mL9. 3 μL of a 45 mM stock solution of a substrate is added to 8 mL of water. Calculate the following values. The substrate molecular weight is 125 g/mol. Substrate volume in mL Dilution factor Substrate number of moles Substrate concentration for the diluted solution in mM Substrate concentration for the diluted solution in mole/L Substrate concentration for the diluted solution in mg/mL
- 29. A topical solution contains 3% w/v hydro- quinone. How many liters of the solution can be prepared from 30 g of hydroqui- none? 29. 1 liter3 mL of a 45 mM stock solution of a substrate is added to 8 mL of water. Calculate the following values. The substrate molecular weight is 125 g/mol. Calculate the following values: Substrate Volume in mL Dilution Factor Substrate number of moles Substrate concentration for the diluted solution in mM Substrate concentration for the diluted solution in mole/L Substrate concentration for the diluted solution in mg/mLhow many grams of sr(no2)2 are needed to make 200 ml of 0.300M solution of sr(no2)2
- . A prescriber ordered 240 mL of ¾ strength Sustacal PO B.I.D. Explain how you would use water as a diluent to mix this solution. Show your work with units and describe how much water and how much Sustacal you would use to create this mixture..Penicillin G potassium 5000 units Isotonic Sodium Chloride Solution ad 15 mL Sig. Nose drop Using soluble penicillin tablets, each containing 100,000 units of crystalline penicillin G potassium, explain how you would obtain penicillin G potassium needed in compounding the prescription.I. How much of a 3X stock of SDS Loading Buffer should you add to 20 uL of sample to make 30 uL of 1X?
- 67. Purified water contains not more than 10 ppm of total solids. Express this concen- tration as a percentage. 67. 0.001% w/v5 L of 0.2 M dextrose solution from 5 M dextrose solution21 Rx KCI Sımple syrup Cherry syrup aa ad 5 mL Sig: I tsp (15 mEg) tid. x 12 days Note: molecular weight of KCI is 74.5 A How many grams of KCI is required to fill this prescription? D. How much simple syrup in milliliters is required to prepare this prescription? (assume KCI occupies no volume) 9.5