I. Effect of pH on ezyme activity pH Test tube Observation I 2 4 4 5 12 Conclusion: 8. 3.
Q: What part of the electron transport chain is responsible for the greatest contribution to oxidative…
A: Protein complexes are present in the inner membrane of mitochondria forming an electron transport…
Q: Which of the following best describes an amino acid that can be used to synthesize proteins?
A: Monoprotic acids - are the acids that donates only one proton (H atom) per molecule of acid to an…
Q: Analysis of a octapeptide revealed the presence of the following products: 2 Arg, 1 Gly, 1 Met, 1…
A: Edman Degradation – This is method of peptide sequencing. In this method amino terminal residue is…
Q: Which of the following statements concerning the enzyme regulation is CORRECT? Select one: A.…
A: Allosteric enzymes have two different binding sites. One is the active site and the other one is the…
Q: Calculate the values of the
A: Enzyme kinetics is a study of the rate of enzyme catalyzed reactions. In Michaelis-Menten kinetics,…
Q: explain serotonin dopamine and gaba and its effects.
A: Serotonin, dopamine and gaba all are the neurotransmitters means all are chemical massengers of…
Q: 29. Here is a strand of DNA: TACCCGGTATAACGCTGGAAAGCTTAAGCAACATCGCCCGACCCC AAATCT…
A: DNA strand given here with directionality is as: 5’…
Q: 1.The 22nd amino acids and the only amino acid * A. Selenocysteine B. Selenicysteine C.…
A: Since you have asked multiple questions, we will solve only first question for you. If you want any…
Q: does HEW have a higher concentration of negatively/neutral charged protein (at ph 7) explain ur…
A: HEW ( hen egg white) is an enzyme specifically known for its ability to degrade the polysaccharide…
Q: Which of the following contain statements that are both correct? Aspartame triggers the…
A: Aspartame is an artificial sweetener. It first binds and activate a GPCR. The G-alpha bound to GTP ,…
Q: Iculate the actual, physiological deltaG for the reaction Phosphocreatine + ADP > creatine + ATP at…
A: Disclaimer: Since you have asked multiple question, we will solve the first question for you. If you…
Q: 1) What is the chemical group at the end of the R groups of basic amino acids that makes them…
A: There are twenty standard amino acids that make up all of the proteins. The twenty standard amino…
Q: A biochemist wants to determine the effect of an inhibitor on a certain enzyme. The data are shown…
A: The rate of enzyme catalyzed reactions is directly proportional to the substrate concentration. But,…
Q: Which of the following samples are expected to cause a decrease in absorbance over time when…
A: Ensuring adequate light reaching a detector by using water colloidal solutions in light or X-ray…
Q: What is the flow of genetic information?
A: The flow of genetic information is always unidirectional. It is depicted in central dogma…
Q: Describe the ion dynamics of the muscle-contraction process.
A: Tension-generating regions within muscle cells are activated during muscular contraction. Muscular…
Q: Lys and Arg Glu and Lys Pro and Asp Among these amino acid combinations listed above, only the…
A: Proteins are composed of a linear chain of amino acids attached together via peptide bonds. All…
Q: Which of the following is INCORRECTLY paired? O Isoelectric focusing : Charge O Gel filtration…
A: 1. Isoelectric focusing IEF is an electrophoretic method for separating proteins based on their…
Q: what is the chemistry of nucleosides?
A: Nucleosides are nothing but glycosamines whose analogues are used as anti cancer agents or antiviral…
Q: Enzymes increase the rate of a chemical reaction by providing an alternative path with a lower…
A: TRUE
Q: king of acid
A: Acid is the substance which turns blue litmus to red. Acid contains more H+ ions. Acids acts as…
Q: Figure 1. Enzyme and potential substrates
A: Enzymes are usually composed of proteins and it catalyzes biochemical reactions in our body. It is…
Q: Failed to follow
A: Waxes are a broad category of organic compounds that are lipophilic and bendable solids at room…
Q: -Inhibitor +Inhibitor [S] (mM) V0&νβσπ; (μmol/sec). V0&νβσπ:&νβ σπ: (μmollsec) 0.0001 33 17 0.0005…
A: Km of an enzyme is the substrate concentration at half Vmax. It can be calculated from lb plot by…
Q: 1. What is the physiologic function of pigments in plants?
A: Pigments are compounds that absorb specific wavelengths and reflect away, the other. Plant parts are…
Q: Aldosterone is glucocorticoid hormone with Na+/K+ balance i the human body. Cortisol is an…
A: The hormones in the body play a central role in maintaining key homeostatic processes in the body.
Q: A polypeptide with a net positive charge at physiologic pH (~7.4) most likely contains amino acids…
A: The pKa values of the side chains of amino acids determine the net charge on a protein at a…
Q: Biochemistry Question: Nonenzymatic glycosylation or glycation creates glycoproteins by
A: Glycoproteins are molecules that comprise protein and carbohydrate chains that are involved in many…
Q: Which of the following condition is NOT associated with riboflavin deficiency? * (Please choose one…
A: Riboflavin is a water soluble vitamin. It is also called as B2 vitamin. Foods like pork, eggs,…
Q: How many activation cycles, Initiation cycles, Elongation cycles and termination cycles are needed…
A: Protein synthesis occurs in four main steps such as activation or charging of tRNA, initiation of…
Q: In sample preparation for electron microscopy, arrange the following steps in correct order A. Apply…
A: Electron microscopy is the technique of visualising the structure of tissues, cells and organelles…
Q: Which of the polysaccharides WILL DECREASE GELLING if acid is added to the sample? pectins…
A: Gels are solid, jelly-like structures made of colloid polysaccharides, proteins, and polymers…
Q: In a paragraph format How amylase is used/its purpose and why amylase useful in the food industry
A: Any enzyme that catalyses the hydrolysis (breaking of a substance by the addition of a water…
Q: The fact that some eukaryotic rRNAs are self-splicing indicates that (A RNA can contain modified…
A: When transcription of DNA to RNA happens the introns are removed either by the RNA itself or by a…
Q: Which statement(s) correctly describe(s) protein structures? A. All hydrophobic residues are buried…
A: Proteins are made up of amino acids, which are the building blocks. Around 20 different amino acids…
Q: 6. DNA electrophoresis uses polyacrylamide gel for separation. a) True b) False 7. Agarose is a…
A: DNA is composed of nucleotides attached via phosphodiester bonds. DNA act as genetic material in…
Q: In the 1step of the 2-step reaction shown below, which substrate/co-substrate is being oxidized?…
A: The above reaction is a part of beta oxidation of fatty acid process.
Q: Which of the following is an incorrect grouping of amino acids based on their properties of the side…
A: Introduction: Amino acid is a compound that contains an amino and a carboxyl group and a side-chain…
Q: III. True or False a. Large proteins travel/migrate faster in both gel filtration chromatography…
A: Different techniques used in the separation and purification of the biomolecules are, Chromatography…
Q: The enzyme is considered to be alan * COO Lactate COO dehydrogenase HO-C-H + NAD 0 + N
A: LDH, or lactic acid dehydrogenase, is an enzyme that is a type of protein. LDH is critical in the…
Q: Briefly describe four ways in which a protein could be denatured.
A: The highly organized structures of proteins are true works of chemical architecture. Denaturation…
Q: Derive the amino acid sequence that is coded for by each of the following mRNA sequence. 5' CAA…
A: Amino acid are molecules which are combine to form a protein molecules.Amino acid are synthesized by…
Q: Suppose you want to determine if excessive lipid ingestion altersgene transcription. Describe and…
A: Dietary fat is a crucial macronutrient for the increase and development of all organisms. In…
Q: Bradford technique
A: The Bradford assay is based on the use of the dye Coomassie Brilliant Blue G-250, sometimes known as…
Q: Describe in detail synaptic termination by enxymes and by reuptake
A: Introduction: Neurotransmitters are chemical messengers that transfer signals from a neuron to a…
Q: 1. What is the effect of increasing the concentration of lactose in the action of the enzyme…
A: "Since you have posted multiple question, we will answer the first question for you. If you want any…
Q: For beta-oxidation of an 18:1 oleate mono-unsaturated fatty acid: - How many Acetyl CoA produced? -…
A: Fatty acids are molecules with hydrocarbon chain and carboxylic acid group. In the absence of…
Q: GIVEN: Centrifuge A: rotor radius - 5 cm; max. speed - 4,000 xg Centrifuge B: rotor radius -7 cm;…
A: Centrifugation is a process that uses centrifugal force to separate mixtures. A centrifuge is a…
Q: Using G-25 Sephadex beads (Fractionation range 1000-5000) KD, a sample of Vitamin B12 (MW ~1500 KD)…
A: Note : Hi ! Thank you for the question. We are authorized to answer one question at a time. Since…
Q: Explain under what conditions "substrate concentration" is the limiting factor for enzymatic…
A: Enzyme and substrate bind each other form E-S complex which decomposes to give product. Substrate…
You can use this as your references: https://www.youtube.com/watch?v=34VkaCJggOM
Step by step
Solved in 2 steps with 2 images
- e/0/S Anemic patient diagnosed clinically through his symptoms which are: weakness, fatigue, shortness of breath, and dizziness. The lab. results of his hemoglobin level was less than 8 g/dl. On the examination of his Red blood cells isolated from the patient showed abnormally low level of lactic acid production. A deficiency of which one of the following enzymes would be the most likely cause of this patient's anemia? * Pyruvate kinase Hexokinase All of the above Phosphofructokinase Phosphoglucose isomerase Lactate dehydrogenaseBiosafety level requirement to identify presence or absence of covid-19Elevated blood plasma levels of alkaline phosphatase (hyperphosphatasaemia) are an indication of a number of pathologies. Briefly comment on the use of alkaline phosphatase assays as a diagnostic aid for a single common medical condition. (word limit 120 words including citations and references.
- 1&1/2 tsp po BID x 14 days #QS How many milliliters should the pharmacy dispense?Calculation about delta standard G, delta H, detla S. Question attached as photo below. And my answer attempted. Need my answer verified and corrected if neccesary. Please let me know where I got wrong and what key ideas I had miss. Thanks.explain detail why in microsytic anemia iron deficency is seen as the main cause, and thalasemia is not.
- Explain in detail why Microsytic anemia is caused by beta thalasemia. Provide deep analysis aloong side examples.Lab Test Comprehensive Metabolic Description Normal Values Clinical Significance if Above/below normal Panel values Albumin: Alkaline phosphatase: ALT (alanine aminotransferase AST (aspartate aminotransferase): BUN (blood urea nitrogen): Calcium: Chloride: CO2 (carbon dioxide): Creatinine: Glucose: Potassium: Sodium: Total bilirubin: Total protein:Assignment on .topic:; please time limit 2hrs please explain. Topic:; Biosynthesis of eicosanoid.
- Prednisone 5mg Quantity: CLXIV 5 tabs po qd x4 d, taper down by one tablet every 5 d for 15 d then ss po qd. how many tablets should be dispensed?Please answer for inhibitos only D.i. Explain the behaviour of the amino acids (Alanine, Lysine, aspartic acid) during the ion exchangeprocedure.ii. Explain the behaviour of the amino acids (Alanine, Lysine, aspartic acid) during TLC. How does thesolvent affect the rate of migration iii. How does the column chromatography the amino acids (Alanine, Lysine, aspartic acid) with fraction eluted with HCl and phosphate buffer have an effect in cellulose TLC and the actual TLC?