Identify which mutagen is described by the following statement. Inserts between adjacent bases in the double helix. [Select] [ Select ] intercalating agent base analogue X-ray aflatoxin UV ray nitrous acid « Previous
Q: Your company has decided to develop a PCR test that will be used to determine Huntington's disease.…
A: The polymerase chain reaction (PCR), is one of the most useful molecular biology techniques used to…
Q: What kind of mutation is present in the following DNA strand?: Wild-type: 3'-AGTCCCTGAAAT-5'…
A: Introduction : Mutation is defined as a change in the DNA sequence. Mutation is an alteration that…
Q: The red line indicates where a radioactively labeled probe hybridizes. Three samples of the genomic…
A: P B PB…
Q: Which of the following types of mutations would be produced by repair of a CRISPR-targeted double…
A: Non Homologous End joining is described as the pathway required for the repairing of those double…
Q: Explain with help of diagrams the mutagenic effects on DNA of following mutagens? Below is an…
A: Introduction: Mutation- These are the random heritable changes that occurs in the DNA sequence among…
Q: Which of the restriction enzymes listed in the table below produces blunt-end fragments? Enzyme…
A: The blunt end are produced by the restriction enzymes when the end of a DNA fragment after breaking…
Q: Transposons are useful as mutagens because they act asmolecular tags for genomic DNA sequences that…
A: Step 1 Transposons or jumping gene is a DNA (deoxyribonucleic acid) sequence that can change its…
Q: Which of the following DNA pol I activities would be MOST important in the removal of the primer? A…
A: The DNA polymerase I has two actions: - Synthesis of Okazaki fragments to complete gaps. 5/ to 3/…
Q: You are working with a newly discovered mutagen, andyou wish to determine the base change that it…
A: Introduction Mutagens often cause alterations in the DNA by changing bases. Substitutions are common…
Q: Fill the Table with mutagenic agents and provide their type (physical, chemical, biological) and…
A: The mutation is a permanent alteration in the nucleotide sequence of DNA molecules. The mutation…
Q: Match the following (most appropriate combinations): Gel filteration chromatography Electrophoresis…
A: 1) Gel filtration chromatography - separation of proteins in a column based on size. In this type of…
Q: You are studying a protein that contains the peptide sequence RDGSWKLVI. The part of the DNA…
A: The restriction endonuclease are responsible for cutting the DNA at specific sequence and they…
Q: You are working with a newly discovered mutagen, and you wish to determine the base change that it…
A: Mutagens often cause alterations in the DNA by changing bases. Substitutions are common examples…
Q: Your mutagenized sample showed 523 CFU after plating 100uL of media on the 10^3 dilution plate. The…
A: CFU/ml = CFU/(Dilution × Volume plated) CFU stands for colony forming units.
Q: Following PCR amplification of a disease gene, you perform sequence analysis using a primer 20…
A: After performing sequencing through gel electrophoresis DNA fragments are organized according to…
Q: The recognition site for Spel is A'CTAGT. Which of the following restriction sites when digested…
A: Restriction site - Each restriction enzyme identify specific sequence of nucleotide, known as…
Q: Identify the mutagenic effects of deaminating agents, alkylating agents, and base analogs. Reset…
A: It can exist in various forms like primary, secondary and tertiary based on its level of complexity.…
Q: A mutagen that is a base analog isa. ethyl methanesulfonate (EMS).b. 5-bromouracil.c. UV light.d.…
A: The DNA is a genetic material- a polynucleotide chain made up of the long chain of A, T, G, and C.…
Q: The enzyme that removes RNA primers attached by Primase is?
A: A primer is a short and single-stranded nucleic acid which is utilized by all living organisms in…
Q: of repairing these dimers at "normal" rates. Such individuals are likely to suffer from…
A:
Q: Identify which mutagen is described by the following statement. Results to the deamination of…
A: Mutagens are substances that induces mutation. Chemical mutagens are certain chemicals that induces…
Q: The chromatogram shows fluorescent peak data from a dye-terminating nucleotide-sequencing reaction.…
A: Sanger sequencing (also known as chain termination sequencing) is a DNA sequencing technology that…
Q: Procedure Restriction maps for Lambda DNA Lambda DNA may exist as a linear or circular molecule. The…
A: The restriction enzyme is the restriction endonuclease which recognises and cut at the specific…
Q: What type of mutations are the most harmful to an organism? Select at least 2 answers Deletion…
A: Mutations are change produced in the structure of DNA. These changes can be introduced either due to…
Q: Another restriction enzyme is called HaellI. It cuts DNA at the following base sequence: CCGG GGCC…
A: restriction enzymes are those enzymes which helps in cutting dna at specific locations .
Q: The plasmid cloning vector pBR322 is cleaved with the restriction endonuclease PstI. An isolated DNA…
A: The following is the DNA information received by gel electrophoresis: In lanes 1 and 2, each…
Q: Which of the following represents a base analog acting as a mutagen? O ethidium bromide O guanine O…
A: In hereditary qualities, a mutagen is a physical or compound specialist that changes the hereditary…
Q: Which of the following mutagens can substitute bases in DNA because of structural similarity?…
A: A mutagen is defined as any physical or chemical substance that can cause a mutation by altering an…
Q: Which one of the following statements is FALSE regarding the Ames test? liver enzymes are added to…
A: Ames test is a test used to determine genotoxicity via a chemical mutagen . It generally work on…
Q: Fill the Table with mutagenic agents and provide their type (physical, chemical, biological) and…
A: Hello. Since your question has multiple sub-parts, we will solve first three sub-parts for you. If…
Q: The DNA sequence of one strand of a gene from threeindependently isolated mutants is given here (5′…
A: The mutant gene produces when there are changes in the sequence of nucleotides in the wild type…
Q: A transposable element or sequence of DNA that can move within the genome Group of answer choices…
A: Transposable elements or sequences of DNA that can move within the genome are also called jumping…
Q: The mutagen that most often causes thymine dimers is/are ________. Group of answer choices…
A: Genetic material is nothing but the sequence of nucleic acids which is called as DNA. It contains…
Q: The partial sequence of one strand of a double-stranded DNA molecule is5′ – – –…
A: Restriction enzymes also called molecular scissors are originally a part of a bacterial defence…
Q: 39. Answer and explain
A: Mutagens are agents which cause mutation. Mutation is the change in the sequence of nucleotides in…
Q: A mutation in which of these proteins will lead to increased mutations in all daughter cells? A.…
A: The mutation is a heritable change that arises due to the alteration of the genomic sequence of an…
Q: Define the following terms:a. nonreplicative transpositionb. replicative transpositionc. composite…
A: Transposons are DNA (deoxyribonucleic acid) segments that have the internal property of movement…
Q: One type of cancer is caused by a mutation that occurs in a gene whose length is 2kb. A 200bp…
A: Introduction The polymerase chain reaction, or PCR, is a chemical reaction used by molecular…
Q: Which of the following mutagens results in the deamination of nitrogenous bases? O nitrous acid base…
A: The amino bases adenine and cytosine lose one amino group when they are oxidised. As a result, in…
Q: What type of mutations are the most harmful to an organism? Select at least 2 answers Duplication…
A: A mutation is a permanent change in the DNA of a cell such that the sequence deviates from what is…
Q: Identify which mutagen is described by the following statement. Results to the deamination of…
A: NOTE: The options are numbered as 1, 2, 3, 4, 5, and 6. DNA(deoxyribonucleic acid) is the basic…
Q: Which of the following sequences in double-stranded DNA is most likely to be recognized as a cutting…
A: Restriction enzymes are also known as molecular scissors because they cut the DNA at specific, short…
Q: The following is an example of what type of mutation? Normal DNA: 5' - ATGACGTCA - 3' Mutated DNA:…
A: Thank you for the question Answer = The correct answer is option A (Deletion). Explanation :- This…
Q: Restriction enzymes are essential tools in genetic engineering. Discuss with diagrams
A: As per our guidelines, we are supposed to answer only one question. Kindly repost the other question…
Q: The restriction endonuclease NotI recognizes the octanucleotide sequence GCGGCCGC. Calculate the…
A: restriction endonuclease is an enzyme that cuts DNA sequences at specific sites.
Q: In the Ames test shown in Figure 16-17, what is the reason for adding the liver extract to each…
A: Ames test is performed to detect the ability of a chemical to cause mutation in the DNA. Histidine…
Q: A conditional mutation when there is an alteration to the coding region of a gene is caused by a.…
A: Introduction :- A conditional mutation can be actively induced by light, temperature, or the…
Q: Restriction mapping of a linear piece of DNA reveals the following EcoRI restriction sites. EcoRI…
A: Introduction By cleaving the internal covalent bonds between nucleotides, endonucleases breaks down…
Step by step
Solved in 2 steps
- Question 5 Review Figure 21.6 types of DNA sequences in the human genome. The lowest percentage of human genome O repetitive DNA related to transposable elements and related sequences (L1 sequences and Alu elements) O repetitive DNA unrelated to transposable elements (simple sequence and large-segment duplications O unique noncoding DNA O introns O exons O regulatory sequencesQuestion 1: The restriction enzyme Sau3A recognizes the sequence 5'-/GATC-3' and cleaves on the 5' side of the G as indicated by the slash. Since the top and bottom strands of this restriction site are identical in the 5'-3' direction, only one strand of the site needs to be shown. The single-stranded ends produced by Sau3A cleavage are identical to those produced by BamHI, which recognizes the sequence 5'-G/GATCC-3' and cuts at the location of the slash. This means that an end cut by one enzyme can be ligated onto an end cut by the other enzyme by DNA Ligase. Given this information, answer the following questions: A) Write out both strands of the recognition sequences for BamHI and Sau3A, show what they would look like after they are cut, and what the DNA would look like after you ligate a BamHI site to a Sau3A site. Make sure that it is easy to follow the individual pieces of DNA. You may want to use two different colors to keep them separate. B) What fraction of BamHI sites can be…Question 6. What are the first three amino acids in the protein that is produced from this gene? Write the amino acids using the three-letter code separated by a hyphen. -35 sequence Pribnow box 5' GATTCCGTATTACAGCATAG GCTATATT CA CGTGGATGGTCAGTA... 3' 3' CTAAGGCATAATGTCGTATCCGATATAAGTG CACCTACCGATCAT... 5' Start site
- Question 43 The addition of restriction endonucleases in the cloning process is done following the ligation with DNA ligase. A) True B) FalseTransposable elements are short segments of DNA, presentin ___________ locations, that move around the genomeQuestion 7. What is the sequence of the primary transcript produced from this gene? -35 sequence Pribnow box 5' GATTCCGTATTACAGCATAGGCTATATTCACGTGGTACGCTA 3' 3' CTAAGGCATAATGTCGTATCCGATATAAGTGCACCATGCGAT 5' Start site
- QUESTION 21 Choose each of the characteristic(s) of all RNA polymerases from the list below. A. elongation adds new ribonucleotides to the 3-OH B. requires a primer to initiate synthesis C. have 3' to 5' exonuclease activity D. adds nucleotides based on sequence complementarity to a template E. have 5' to 3' polymerase activity O F. elongation adds new ribonucleotides to the 2'-OH G. have 3' to 5' polymerase activityQuestion 20 : The restriction map of the plasmid pSC48 is presented below. The numbers in parentheses correspond to the position of the respective restriction site with respect to position (0). (0) BamHI ЕcoRI (4640) (620) PSC48 5200 pb BamHI (1130) Smal ЕcoRI (3420) (1350) The plasmid has been digested by one or several restriction enzyme(s). The digestion products have been analysed by agarose gel electrophorese. (see figure below). 1 2 10,000 8,000 6,000 5,000 4,000 3,000 2,500 –2,000 - 1,500 -1,000 -750 - 500 -250 1. Digestion products 2. Size marker base pairs Which restrcition enzyme(s) have been used for the digestion? (Indicate the right answer) А- ЕсoRI. B- EcoRI/BamHI. C- EcoRI/Smal. D- BamHI. E- Smal. | |Question 39 The graphic below shows Taq polymerase extending the primer upon a strand of DNA. What is a possible resulting sequence of the complementary strand after the reaction is finished assuming adequate amounts of all normal nucleotides and some ddGTP? 5' 5' O GATGC O TGCG O ATGC AGATGC с POLYMERASE 3" T G C '5' 3º in
- Question 7 (2 points) Determine the matching base pairs that RNA polymerase would lay down for this DNA sequence: TGCAGACT *record your answer with no spaces, dashes, or other charactersQuestion 3 Review transcription. Match the term and its description. Each term can only be used once. RNA synthesis is catalyzed by this enzyme called | Choose ) The DNA sequence where RNA polymerase attaches is called | Choose | In bacteria, the sequence signaling the end of transcription is called | Choose J The stretch of DNA that is transcribed is called | Choose | These factors mediate the binding of RNA polymerase and the | Choose initiation of transcription > > >QUESTION 1 The sequence of a DNA including the gene that you want to clone into a plasmid vector. The gene of interest is in bold with the stop codon shown in green. The sequence has no suitable restriction site for digestion to isolate the gene fragment for cloning. Recognition site of Sal-I enzyme is given below. Design a primer to introduce the Sal-I site to the beginning of the gene. Write the complementary DNA sequence Design the primer and show which strand of DNA it is complementary to Mark the direction of all DNA sequences including the primer. 5-TGTCAGCACCATCTGTCCGGTCCCAGCATGCCTTCTGAGACCCAGGCAG(1500b)TGGGGCTGACTCTTTA-3 Sal-1 recognition site GTCGAC CAGCTG THIS IS COMPLETE QUESTION. PLEASE EXPLAIN EACH PART OF GTHE QUESTION.