Which of the restriction enzymes listed in the table below produces blunt-end fragments? Enzyme Cleavage site Alul AG|CT Hindll AJAGCTT BamHI G|GATCC EcoRI GJAATTC BgllI A|GATCA Alul O BamHI O Bell O EcoRI O Hindll
Q: Which of the following sequences is most likely to be recognized and cut by a 6- cutter restriction…
A: Restriction enzyme is an enzyme that cuts DNA into small fragments at specific sites within…
Q: A circular DNA of 40 kb (40,000 bases) length is cut with a restriction enzyme whose precise…
A: The probability of a restriction enzyme to be found in a DNA is 4n, where n is the number of bases…
Q: The recognition sequence for the restriction enzyme TaqI is T↓CGA. Indicate the products of the…
A: Restriction enzyme is a protein that recognizes a specific, short nucleotide sequence and cuts the…
Q: RFLP analysis involves the following, except ________ . a. more than one restriction sites b.gene…
A: Restriction Fragment Length Polymorphism An enzymatic process called RFLP is used to separate and…
Q: The restriction enzyme BamHI recognizes the sequence GGATCC and cuts the DNA between the two G’s.…
A: Ans: Restriction enzymes: The enzymes which cuts the DNA at specific site and used in cloning is…
Q: Based on the restriction enzyme specificities given below, which will generate blunt ends?…
A: Restrictions enzyme or restrictions endonucleases is type of protein, produces bacteria that helps…
Q: Based on the restriction enzyme specificities given below, what was the enzyme utilized to produce…
A: An enzyme that recognizes a specific sequence on the DNA strand and cuts the DNA into fragments is…
Q: Most prokaryotic organisms produce one or more enzymes to defend themselves against the infection by…
A: Bacteria constitute a wide domain of prokaryotic microbes with majorly varying lengths and a number…
Q: This is a restriction map for the 250 base pair plasmid pSage. Restriction sites for the restriction…
A: Restrictions endonucleases are enzymes that cut down the DNA into fragments near or at the site of…
Q: A molecule of double-stranded DNA that is 5 million base pairs long has a base composition that is…
A: Let us consider the probability of finding the restriction sites in DNA at any position is '1 in x',…
Q: Which of the following enzymes are NOT used in recombinant DNA technology O A. Eco RI O B. Ligase O…
A: INTRODUCTION Recombinant DNA (rDNA) is a process of joining DNA molecules from two different sources…
Q: The restriction endonuclease NotI recognizes the octanucleotide sequence GCGGCCGC. Calculate the…
A: Restriction endonucleases are enzymes that cut DNA sequences at a specific site known as a…
Q: Restriction Enzyme Specificities: GAATTC... Hpal.GTTAAC... ..CTTAAG... PstI .CTGCAG... ..GẠCGTC...…
A: Restriction enzyme is protein found in bacteria which cleaves DNA at specific sites along the…
Q: Based on the restriction enzyme specificities given below, which will generate blunt ends?…
A: When a DNA fragment is subjected to the action of a restriction endonuclease enzymes, it cuts the…
Q: Based on the restriction enzyme specificities given below, what was the enzyme utilized to produce…
A: The corner stone of genetic engineering or recombinant DNA technology is a special class of enzymes…
Q: What are restriction enzymes and what do they do? Complete the chart Driginal DNA sequence 5' TGA…
A: Restriction enzymes bind and cleave double-stranded DNA. There are three categories of restriction…
Q: You are studying a protein that contains the peptide sequence RDGSWKLVI. The part of the DNA…
A: The restriction endonuclease are responsible for cutting the DNA at specific sequence and they…
Q: The same restriction endonuclease must be used to excise the foreign DNA and bacterial DNA. Select…
A: DNA or deoxyribonucleic acid is a double-stranded molecule, strands of which are coiled around one…
Q: Your mutagenized sample showed 523 CFU after plating 100uL of media on the 10^3 dilution plate. The…
A: CFU/ml = CFU/(Dilution × Volume plated) CFU stands for colony forming units.
Q: The recognition site for Spel is A'CTAGT. Which of the following restriction sites when digested…
A: Restriction site - Each restriction enzyme identify specific sequence of nucleotide, known as…
Q: Based on the restriction enzyme specificities given below, which will generate blunt ends?…
A: The given restriction enzymes are endonucleases as they cut nucleotides at specific positions within…
Q: Suppose that a geneticist discovers a new restriction enzyme in the bacterium Aeromonas ranidae.…
A: Restriction enzymes or restriction endonucleases are the enzymes that cut the DNA strand at specific…
Q: GAATTC GAATTO CITAAG CITAAG double-stranded DNA DAATT DAATTO CTAA G CTAA GI AAT TO CTTAA GAATTO…
A: The cloning is routinely used in biotechnology laboratories and it is the process by which a foreign…
Q: Which of the following can be termed as a restriction modification system?a) Restriction…
A: Enzymes are the biological catalysts which are proteinaceous in nature. The function of an enzyme is…
Q: Which of the following is most likely to be a restriction enzyme recognition sequence? O AAAAAA O…
A: A palindromic sequence is a sequence of nucleic acids within double helix of DNA and / or RNA that…
Q: Procedure Restriction maps for Lambda DNA Lambda DNA may exist as a linear or circular molecule. The…
A: The restriction enzyme is the restriction endonuclease which recognises and cut at the specific…
Q: Dr. Doom has a DNA sequence of 2000 bp. Enzyme X and Enzyme Y restriction sites and their positions…
A: Restriction enzymes are the enzymes which cut DNA at particular site.
Q: Technique whereby inserting DNA into a clone is accomplished using two different restriction enzymes
A: Directional cloning is the technique which is accomplished by cleaving the plasmid vector with two…
Q: A restriction endonuclease, REI, recognize AAGCTT and cleaves between A and A in the sequence. Given…
A: Answer: RESTRICTION ENDONUCLEASE : It is the enzyme which is used to cut the DNA at specific sites…
Q: Kha Vu Danels Include: 8DX : Safehy Jor bromie tnto lab repart! Name Section date sheet MAPPING…
A: The restriction enzymes are type of nuclease enzymes. These enzymes have the capability to cleave…
Q: Tailed primer can have restriction enzyme sites. True False
A:
Q: An E. coli genomic DNA fragment is run out on a gel undigested (U), and then with two different…
A: Restriction enzymes are those enzyme which recognise a specific recognition site in DNA and cuts the…
Q: Which of the enzymes from the following list wouldyou need to make a recombinant DNA molecule?…
A: The recombinant DNA is where the two or more DNA molecules are integrated into a vector plasmid to…
Q: Which of the following sequences in double-stranded DNA ismost likely to be recognized as a cutting…
A: Enzymes that can cleave the DNA at specific sites are known as restriction enzymes. There are two…
Q: A circular DNA molecule is subjected to complete restriction digestion by (1) BamHI alone, (2)…
A: Restriction enzymes cut DNA at a specific location called as restriction site.
Q: Which restriction endonucleases would cleave a DNA molecule at the given sequences? The…
A: Restriction endonucleases are found in bacteria and they cut double-stranded DNA at the…
Q: You are setting up a restriction digest of pUC19. The DNA concentration is 76.4ng/ul. You want to…
A: introduction Restriction Digestion is that the process of cutting DNA molecules into smaller pieces…
Q: It is difficult to use a restriction enzyme that cuts (shown as ) within one of these restriction…
A: Ans- It is difficult to use a restriction enzyme that cuts like the sequence given in option D( *…
Q: Table 1 shows a list of restriction endonucleases with their recognition sequence and the sites of…
A: Restriction enzymes are those that cleave the double stranded DNA at specific site. They have…
Q: #2 EcoRI --- 5’ G ↓AATTC 3’ 5’ ACG ACGTATTAGAATTCTTA TCCGCCGCCGGAATTCT CATCA 3’ 3’ TGC…
A: Restriction enzymes is an enzyme that cleaves DNA into fragments. Recognition sequence is a unique…
Q: Identify which mutagen is described by the following statement. Results to the deamination of…
A: NOTE: The options are numbered as 1, 2, 3, 4, 5, and 6. DNA(deoxyribonucleic acid) is the basic…
Q: Which of the following single-stranded DNA molecules may possibly be a restriction enzyme target cut…
A: Restriction enzymes are specific endonuclease that are responsible for cutting double standard DNA…
Q: The recognition site of some restriction enzymes are shown. Which will produce sticky ends? A.…
A: Restriction enzymes also known as restriction endonucleases are the enzymes which acts on the…
Q: The restriction endonuclease NotI recognizes the octanucleotide sequence GCGGCCGC. Calculate the…
A: restriction endonuclease is an enzyme that cuts DNA sequences at specific sites.
Q: A linear DNA fragment was produced by digestion with the restriction enzyme, Xba1. This fragment…
A: DNA or deoxyribonucleic acid is a polymer of deoxyribonucleotides connected together via…
Q: The recognition sites for the restriction enzymes BamHI, Xbal, and Bglll are G^GATCC, T^CTAGA, and…
A: Since it is the multiple choice question i will provide answer in next step.
Q: FIGURE 2 shows the only suitable DNA restriction site in a plasmid DNA vector that can be cleaved.…
A: Restriction enzymes are the most important tool in genetic engineering. These enzymes have the…
Q: 3 HaelII --- 5’ CC ↓ GG 3’ 5’ ACGCCGGCCGTATTAT CCGGATCCGCCG CCGGCTGTCCCGGATCA 3’ 3’…
A: A restriction enzyme is a type of enzyme which cleaves DNA into fragments at a specific recognition…
Q: Restriction mapping of a linear piece of DNA reveals the following EcoRI restriction sites. EcoRI…
A: Introduction By cleaving the internal covalent bonds between nucleotides, endonucleases breaks down…
Trending now
This is a popular solution!
Step by step
Solved in 2 steps
- What restriction enzyme (or enzymes) would you use to cut the following... (Gene of Interest is Bolded) 1 tctagagtca tgaaacaaca aaaacggctt tacgcccgat tgctgacgct gttatttgcg 61 ctcatcttct tgctgcctca ttctgcagca gcggcggcaa atcttaatgg gacgctgatg 121 cagtattttg aatggtacat gcccaatgac ggccaacatt ggaagcgttt gcaaaacgac 181 tcggcatatt tggctgaaca cggtattact gccgtctgga ttcccccggc atataaggga 241 acgagccaag cggatgtggg ctacggtgct tacgaccttt atgatttagg ggagtttcat 301 caaaaaggga cggttcggac aaagtacggc acaaaaggag agctgcaatc tgcgatcaaa 361 agtcttcatt cccgcgacat taacgtttac ggggatgtgg tcatcaacca caaaggcggc 421 gctgatgcga ccgaagatgt aaccgcggtt gaagtcgatc ccgctgaccg caaccgcgta 481 atttcaggag aacacctaat taaagcctgg acacattttc attttccggg gcgcggcagc 541 acatacagcg attttaaatg gcattggtac cattttgacg gaaccgattg ggacgagtcc 601 cgaaagctga accgcatcta taagtttcaa ggaaaggctt gggattggga agtttccaat 661 gaaaacggca actatgatta tttgatgtat gccgacatcg attatgacca tcctgatgtc 721 gcagcagaaa ttaagagatg gggcacttgg tatgccaatg…#1 HindII --- 5’ GTC ↓ GAC 3’ 5’ ACGACGTAGTCGACTTATTAT GTCGACCCGCCGCGTGTCGACCATCA 3’ 3’ TGCTGCATCAGCTGAATAATACAGCTGGGCGGCGCACAGCTGGTAGT 5’ Restriction enzyme: Recognition sequence: Number of pieces of DNA: Type of cut:#4 BamI --- 5’ CCTAG ↓G 3’ 5’ ACGCCTAGGACGTATTATCCTAGGTAT CCGCCGCCGT CATCA 3’ 3’ TGCGGATCCTGCATAATAGGATCCATAGGCGGCGGCAGTAGT 5’ Restriction enzyme: Recognition sequence: Number of pieces of DNA: Type of cut:
- #2 EcoRI --- 5’ G ↓AATTC 3’ 5’ ACG ACGTATTAGAATTCTTA TCCGCCGCCGGAATTCT CATCA 3’ 3’ TGC TGCATAATCTTAAGAATAGGCGGCGGCCTTAAGAGTAGT 5’ Restriction enzyme: Recognition sequence: Number of pieces of DNA: Type of cut:#3 HaelII --- 5’ CC ↓ GG 3’ 5’ ACGCCGGCCGTATTAT CCGGATCCGCCG CCGGCTGTCCCGGATCA 3’ 3’ TGCGGCCGGCATAATAGGCCTAGGCGGCGGCCGACAGGGCCTAGT 5’ Restriction enzyme: Recognition sequence: Number of pieces of DNA: Type of cut:FIGURE 2 shows the only suitable DNA restriction site in a plasmid DNA vector that can be cleaved. 5'.GTAATCCGGATCCGAAATCCCCCGG... 3' 3.CATTAGGCCTAGGCTTTAGGGGGCCC... 5 FIGURE 2 Identify the most suitable enzymeto be used as a restriction enzyme forthis purpose. O Ligase O Smal O EcoRI О ЕсoRV
- 18. You want to express hemoglobin beta (HBB) in a bacteria model using a vector. You would like to amplify the following gene by PCR. GTAGAATATG ATAAGCGAAA CTGCAAATCG CGTTTGGGGC GATACAAGTA GTGTACGCGG ACCGCGCCGA GCGGGCTATG GTTTCTCCAC TATCAGTTCT TCTCCTGTCC CAGCGAAGTC GAGGTCCAGC CCTACGGTAC ATAACTAACA CGGTTTGAAG AAGATACGAT CTTACGAAGT AAAGAAAATT TGTAGTCAGC CCGGTTCGCT TGTGTCCAGC TAATCGATTG ATTGGCCCCA GCAGGCGAGA TGAACATAGT CATGCGCTGT CTAATAGCCC ATTTGACGTG TAGGTGGCGC TTTTATTTCT GAGGTGGAAA T a) If the primers were both 20 nucleotides long, what are the sequences for both PCR primers that will amplify only the highlighted region? Be sure to label the 5' and 3' ends. (4 points) b) What is the length (in bp) of the entire region amplified by their primers (i.e. the amplicon length)? (Note: the spacing in the above sequence is intentionally uniform) (2 points) c) If you start with 300 copies template DNA how many copies would you expect to produce if you ran the PCR for 22 cycles? Show your work.…Utilizing Hind III and EcoR V Restriction Enzyme with Pet41 and the following gene of interest... a tgaaacaaca aaaacggctt tacgcccgat tgctgacgct gttatttgcg 61 ctcatcttct tgctgcctca ttctgcagca gcggcggcaa atcttaatgg gacgctgatg 121 cagtattttg aatggtacat gcccaatgac ggccaacatt ggaagcgttt gcaaaacgac 181 tcggcatatt tggctgaaca cggtattact gccgtctgga ttcccccggc atataaggga 241 acgagccaag cggatgtggg ctacggtgct tacgaccttt atgatttagg ggagtttcat 301 caaaaaggga cggttcggac aaagtacggc acaaaaggag agctgcaatc tgcgatcaaa 361 agtcttcatt cccgcgacat taacgtttac ggggatgtgg tcatcaacca caaaggcggc 421 gctgatgcga ccgaagatgt aaccgcggtt gaagtcgatc ccgctgaccg caaccgcgta 481 atttcaggag aacacctaat taaagcctgg acacattttc attttccggg gcgcggcagc 541 acatacagcg attttaaatg gcattggtac cattttgacg gaaccgattg ggacgagtcc 601 cgaaagctga accgcatcta taagtttcaa ggaaaggctt gggattggga agtttccaat 661 gaaaacggca actatgatta tttgatgtat gccgacatcg attatgacca tcctgatgtc 721 gcagcagaaa ttaagagatg gggcacttgg tatgccaatg aactgcaatt ggacggtttc 781…Kha Vu Danels Include: 8DX : Safehy Jor bromie tnto lab repart! Name Section date sheet MAPPING PRACTICE #1 Below is a restriction map for the plasmid PGEN 101 (total length = 20 Kb). Using this map as a guide, give the number of restriction fraqments along with their associated lengths that would result from digesting PGEN 101 with the restriction enzymes EcoRI, BamHI and a combination of ECORI and BamHI. BamHI 3.2 Kb 1.7 Kb EcoRI BamHI PGEN 101 8.7 Kb 5.5 Kb .9 Kb EcoRI ECORI DIGESTION PERFORMED SIZES OF FRAGMENTS OBTAINED 10.4 kb , 0.9kb, 8.7 Kb EcoRI 3.2 Kb, 16. 8kb BamHI EcoRI + BamHI
- Given below is the DNA template. What are the gene products? 3’ TACCGGCCTATCTAGGGCCATGGCTTAATTCCC 5’ 5’ ATGGCCGGATAGATCCCGGTACCGAATTAAGGG3’Please determine the relative location of the three restriction enzymes. Enzyme Number of fragments Size (kb) Xbal 2 17, 21 Xhol 2. 5, 33 Xbal/Xhol 5, 12, 21 Kpnl 6, 7, 58 Xbal/Kpnl 6, 7, 8, 17| Choose ) [Choose ) electroporation restriction fragments sticky end expression vector