Imagine you are able to incorporate a heavy isotope into the atoms of both strands of doublestranded DNA. When these strands are replicated, the daughter strands do not contain the label.After two generations of semi-conservative DNA replication, how many single strand pieces ofDNA will contain that label, if you only consider the products the second generations? Hint...drawit out!One set of paired labeled strands and 3 sets of paired non-labeled strands for 4 double-stranded pieces ofDNA totalFour sets of 1 labeled strand paired with 1 non-labeled strand for 4 double-stranded pieces of DNA totalOTwo sets of paired labeled strands and 6 sets of paired non-labeled strands for 8 double-stranded pieces ofDNA totalOTwo sets of 1 labeled strand paired with 1 non-labeled strand, and 2 sets of paired non-labeled strands for 4double-stranded pieces of DNA total

Replication is a process wherein a daughter strand is synthesized using the parent's DNA strand. One…

Answered: Imagine you are able to incorporate a…

Biochemistry

9th Edition

ISBN:9781319114671

Author:Lubert Stryer, Jeremy M. Berg, John L. Tymoczko, Gregory J. Gatto Jr.

Publisher:Lubert Stryer, Jeremy M. Berg, John L. Tymoczko, Gregory J. Gatto Jr.

Chapter1: Biochemistry: An Evolving Science

Section: Chapter Questions

Problem 1P

See similar textbooks

Similar questions

One strand of a single DNA helix is labeled red while the other strand of the same DNA helix is labeled blue. This double helix DNA is replicated through the process of semi-conservative replication. Note that a completely newly synthesized strand of DNA will be white. After three rounds of DNA replication, how many all-white DNA (both strands are white) will there be? Explain your reasoning.
Consider the following segment of DNA, which is part of a linear chromosome: LEFT 5’.…TGACTGACAGTC….3’ 3’.…ACTGACTGTCAG….5’ RIGHT During DNA replication, this double-strand molecule is separated from the right to the left into two single strands and the replisome is moving from the right to the left of the segment. ___________ should be the template for the lagging strand synthesis. neither of the two strands the bottom strand both top and bottom strands the top strand
Consider the following segment of DNA, which is part of a linear chromosome: LEFT 5’.…TGACTGACAGTC….3’ 3’.…ACTGACTGTCAG….5’ RIGHT During DNA replication, this double-strand molecule is separated from the right to the left into two single strands and the replisome is moving from the right to the left of the segment. The replisome is approaching to a chromosomal end on the left. Considering this left chromosomal end, if without telomerase, the newly synthesized daughter DNA of ___________ will be shortened? neither top or bottom strand both top and bottom strands the top strand the bottom strand
The E. coli chromosome is 1.28 mm long. Under optimal conditions the chromosome is replicated in 40 minutes. (a) What is the distance traversed by one replication fork in 1 minute? (b) If replicating DNA is in the B form (10.4 base pairs per turn), how many nucleotides are incorporated in 1 minute in one replica- tion fork? (c) If cultured human cells (such as Hela cells) replicate 1.2 m of DNA during a 5-hour S phase and at a rate of fork movement one- tenth of that seen in E. coli, how many origins of replication must the cells contain? (d) What is the average distance, in kilobase pairs, between these origins?
(d) Write down the sequences of the templates that would give the tetranucleotides shown in I and II. In each case, label the 5' and 3' ends and indicate which template base is used first. (e) What difference would it make to bidirectional DNA replication if both modes of chain extension were equally favourable? I II
When DNA replication was investigated by using heavy, N15 DNA to mark the original molecules, and light, N14 DNA to mark the newly synthesized molecules, one band was found in the middle of the centrifuge column after one round of replication, and two bands were found (middle and top of column) after 2 rounds of replication. Imagine that after 1 round of replication 2 bands were found, one at the bottom and one at the top of the centrifuge column. In that case, what model of DNA replication would have been supported? The dispersive model The conservative model The Franklin model The semi-conservative model
The E. coli chromosome is 1.28 mm long. Under optimal conditions, thechromosome is replicated in 40 minutes.(a) What is the distance traversed by one replication fork in 1 minute?(b) If replicating DNA is in the B form (10.4 base pairs per turn), how manynucleotides are incorporated in 1 minute in one replication fork?(c) If cultured human cells (such as HeLa cells) replicate 1.2 m of DNAduring a five-hour S phase and at a rate of fork movement one-tenthof that seen in E. coli, how many origins of replication must the cellscontain?(d) What is the average distance, in kilobase pairs, between these origins?
On the right of the replication fork, which DNA strand (top or bottom) will be the template for Okazaki fragment synthesis? What will be the leading strand DNA sequence from the region 1 (answer with DNA sequence)? The following origin of replication is found on E. coli chromosome. The DNA sequence of region 1 is shown below: Region I (Top strand): 5'....CTGACTGACA...3'. 5 < top ofi bottom Region 1 in
Suppose that the double stranded DNA molecule shown was broken at the sites indicated by the gaps in the sequence, and before the gaps were repaired, the fragment in the middle was inverted. Show the sequence of the repaired DNA molecule. Keep the 5’-3’ polarity of the DNA strands and DNA polymerases in mind.) 5’- TAAGCGTAACACGCTAA CAGTAATGCAGAACT GGGTCCTATTTTCGTGCGTACAC – 3’ 3’- ATTCGCATTGTGCGATT GTCATTACGTCTTGA CCCAGGATAAAAGCACGCATGTG -5’ Please note that there are 2 gaps. The second one is between the lines (between T & G in the 1st strand and A & C in the second strand)
In an experiment, you grow bacterial cells for several generations in the presence of a light isotope of carbon (C¹2) and then transfer them into a medium containing a heavy isotope of carbon (C¹³). After one round of DNA replication, which of the following statements is true? O All DNA molecules will be labeled entirely with C¹3 ● For all DNA molecules, each strand will be labeled with a mixture of C¹2 and C¹³. Half the DNA molecules will be labeled with C¹2 only, whereas the other half will be labeled with C¹3 only. O All DNA molecules will be labeled entirely with C¹2 O For all DNA molecules, one strand will be entirely labeled with C¹2, whereas the other strand will be entirely labeled with C¹3 O Insufficient information to conclude.
The diagram depicts one strand of DNA at the end of a chromosome. This strand has been replicated and produced two fragments, as shown below. Which of the two gaps that exist, labeled (a) and (b), can be filled by DNA polymerase? Hint: remember the directionality requirement for DNA polymerase. a) gap (a) b) gap (b) c) both gaps (a) and (b) d) neither gaps (a) nor (b)
Sketch a LARGE labeled figure showing one replication fork and the synthesis of one leading strand and two lagging strands of DNA in the replication bubble. Label the 5’ and 3’ ends of all DNA strands shown in your figure. Also label any DNA polymerases, DNA helicases, primases and primers. (For this question you may assume that lagging strands have not been joined.)

SEE MORE QUESTIONS

Recommended textbooks for you

Biochemistry

ISBN:

9781319114671

Author:

Lubert Stryer, Jeremy M. Berg, John L. Tymoczko, Gregory J. Gatto Jr.

Publisher:

W. H. Freeman

Lehninger Principles of Biochemistry

Biochemistry

ISBN:

9781464126116

Author:

David L. Nelson, Michael M. Cox

Publisher:

W. H. Freeman

Fundamentals of Biochemistry: Life at the Molecul…

Biochemistry

ISBN:

9781118918401

Author:

Donald Voet, Judith G. Voet, Charlotte W. Pratt

Publisher:

WILEY

Biochemistry

ISBN:

9781319114671

Author:

Lubert Stryer, Jeremy M. Berg, John L. Tymoczko, Gregory J. Gatto Jr.

Publisher:

W. H. Freeman

Lehninger Principles of Biochemistry

Biochemistry

ISBN:

9781464126116

Author:

David L. Nelson, Michael M. Cox

Publisher:

W. H. Freeman

Fundamentals of Biochemistry: Life at the Molecul…

Biochemistry

ISBN:

9781118918401

Author:

Donald Voet, Judith G. Voet, Charlotte W. Pratt

Publisher:

WILEY

Biochemistry

ISBN:

9781305961135

Author:

Mary K. Campbell, Shawn O. Farrell, Owen M. McDougal

Publisher:

Cengage Learning

Biochemistry

ISBN:

9781305577206

Author:

Reginald H. Garrett, Charles M. Grisham

Publisher:

Cengage Learning

Fundamentals of General, Organic, and Biological …

Biochemistry

ISBN:

9780134015187

Author:

John E. McMurry, David S. Ballantine, Carl A. Hoeger, Virginia E. Peterson

Publisher:

PEARSON

SEE MORE TEXTBOOKS