Question 10 ◄ Listen If a DNA sequence changes from 5' AGA to 5' TGA 3', the result will be a บบบ UUC UUA UCU UAU UGU Phe Tyr Cys UCC UAC UGC Ser UUG} UCA UAA Leu UCG UAG} Stop UGA Stop UGG Trp CUU CCU CAU CGU His CUC CCC CAC CGC Leu Pro Arg CUA CCA CAA CGA CUG CCG CAG} Gln CGG AUU ACU AAU AUC lle ACC Thr AAC } AGU Asn Ser AGC AUA ACA AAA AUG Met ACG AAG } Lys AGA AGG } Arg GUU GCU GAU GGU GUC GCC GAC Asp GGC Val Ala Gly GUA GCA GAA GUG GCG GAG } GGA Glu GGG a) Missense mutation b) Frameshit c) Nonsense mutation d) Silent subsitution

Question 10 ◄ Listen If a DNA sequence changes from 5' AGA to 5' TGA 3', the result will be a บบบ UUC UUA UCU UAU UGU Phe Tyr Cys UCC UAC UGC Ser UUG} UCA UAA Leu UCG UAG} Stop UGA Stop UGG Trp CUU CCU CAU CGU His CUC CCC CAC CGC Leu Pro Arg CUA CCA CAA CGA CUG CCG CAG} Gln CGG AUU ACU AAU AUC lle ACC Thr AAC } AGU Asn Ser AGC AUA ACA AAA AUG Met ACG AAG } Lys AGA AGG } Arg GUU GCU GAU GGU GUC GCC GAC Asp GGC Val Ala Gly GUA GCA GAA GUG GCG GAG } GGA Glu GGG a) Missense mutation b) Frameshit c) Nonsense mutation d) Silent subsitution

Human Anatomy & Physiology (11th Edition)

11th Edition

ISBN:9780134580999

Author:Elaine N. Marieb, Katja N. Hoehn

Publisher:Elaine N. Marieb, Katja N. Hoehn

Chapter1: The Human Body: An Orientation

Section: Chapter Questions

Problem 1RQ: The correct sequence of levels forming the structural hierarchy is A. (a) organ, organ system,...

See similar textbooks

Similar questions

Question 7. What is the sequence of the primary transcript produced from this gene? -35 sequence Pribnow box 5' GATTCCGTATTACAGCATAGGCTATATTCACGTGGTACGCTA 3' 3' CTAAGGCATAATGTCGTATCCGATATAAGTGCACCATGCGAT 5' Start site
QUESTION 6 To verify the is indeed inside your plasmid, you'd like to do a colony PCR. But you need primers for your reaction. Which of the following primer pairs would probably work for verifying your insert is actually present in the plasmid? 5' ATGTTTATTTTCTTATTATTTTTTACTCTCACTAGTGGTAGTGACCTTGACCGGTGCACCACTTTTGATG ATGTTCAAGCTCCTAATTACACTCAACATACTTCATCTATGAGGGGGG TTTACTATCCTGATGAAATTTT (Very long, but a bunch of nucleotides her e).... TCTTGCTTTGTTGCATGACTAGTTGTTGCAGTTGCCTCAAGGGTGCATGCTCTTGTGGTTCTTGCTGCAA GTTTGATGAGGATGACTC TGAGCCAGTTCTCAAGGGTGTCAAATTACATTACACATAA 3' Forward: 5' GGT AGT GAC CTT GAC CGG 3' Tm= 59.8 O A. Reverse: 5' CAA ATT ACA TTA CAC ATA A 3' Tm= 47.4 Forward: 5' ATG TTT ATT TTC TTA TTA TTT 3' Tm= 47.1 C O B. Reverse: 5' TAT GTG TAA TGT AAT TTG ACA CCC 3' Tm3 58.4 Forward: 5' GGT AGT GAC CTT GAC CGG 3' Tm3 59.8 OC. Reverse: 5' GTG TAA TGT AAT TTG ACA CCC TTG 3' Tm: 59.4 Forward: 5' GGT CAC TAC CAC TAG TGA GAG 3' 59.4 C O D. Reverse: 5' GTG TAA TGT AAT TTG ACA CCC TTG…
QUESTION 1 You want to perform PCR on the CDNA of the spike gene from a SARS CoV-2 sample so that you can sequence it. Based on the sequence below, which of the following primer pairs would probably work for PCR of this gene? Spike gene Sequence: 5' ATGTTTATTTTCTTATTATTTTTTACTCTCACTAGTGGTAGTGACCTTGACCGGTGCACCACTTTTGATG ATGTTCAAGCTCCTAATTACACTCAACATACTTCATCTATGAGGGGGGTT TACTATCCTGATGAAATTTT. .. (it's really long so didn't post the whole thing.).TCTTGCTTTGTTGCATGACTAGTTGTTGCAGTTGCCTCAAGGGTGCATGCTCTTGTGGTTCTTGCTGCAA GTTTG ATGAGGATGACTCTGAGCCAGTTCTCAAGGGTGTCAAATTACATTACACATAA 3' Forward primer: 5' - CTC TCA CTA GTG GTA GTG ACC - 3' (Tm = 60.5 °C in a standard qPCR mix) Reverse Primer: 5' GGG TGT CAA ATT ACA TTA CAC ATA - 3' (Tm= 59.6 °C in a standard QPCR mix) Forward Primer: 5'- ATG TTT ATT TTC TTA TTA TT -3' (Tm=D 47.2 °C in a standard qPCR mix) Reverse Primer: 5'- GCA AGA ACC ACA AGA GCA TGC ACC -3' (Tm= 68 °C in a standard qPCR mix) Forward primer: 5' - CTC TCA CTA GTG GTA GTG ACC -3'…
QUESTION 10 You grow this weird looking organism in lab and have no idea what it is. You decide to sequence its genome and one of the reads you get back is shown below: >UnknownSequence1 GCGGTATTTGACGCCGCATTCGAAGTGGTCGATCCATTCGGCGTATCAGGACAATTTGCATATGTTGACGTTGTCGCGGGGTGGGCCCTCGATCTGGATGTCGGAGCGGGACGCG GCGAAGATCGGTGTGGCCGATAATGATTGGATCGAGGCGGTCAATCGTAACGGGGTGGTGGTGGCGCGGGCGATCGTGT
QUESTION 7 Shown here is a DNA sequence. The promoter is highlighted in yellow and the terminator is highlighted in blue. Transcription begins 10 bases from the promoter. How many amino acids does this protein have in total? 5'-ATATTTGCTAGACTGTCGCTCCGATCTGTACTTGATGCGATTČGGATCCCCGCTCCGATCGTAGGAGATTGCTGTTTTAC-3' 3'-TATAAACGATCTGACAGCGAGGCTAGACATGAACTACGCTAAGCCTAGGGGCGAGGCTAGCATOCCTCTAACGACAAAATG -5' Promoter Terminator O 5 O 6 O 7 0 8 O 10 O 11 O 12 O More than 12
Question 6 There is an addition of Adenine in the MRNA sequence specifically at AUG codon. missense mutation O nonsense mutation O silent mutation O frameshift mutation
QUESTION 3 Shown here is a DNA sequence. The promoter is highlighted in yellow and the terminator is highlighted in blue. Transcription begins 10 bases from the promoter. What are the first 4 amino acids in this protein? 5'-ATATTTGCTAGACTGTCGCTCCGATCTGTACTTGATGCGATTČGGATCCCCGCTCCGATCGTAGGAGATTGCTGTTTTAC-3' 3'-TATAAACGATCTGACAGCGAGGCTAGACATGAACTACGCTAAGCCTAGGGGCGAGGCTAGCATCCTCTAACGACAAAATG -5' Terminator Promoter O lle-Phe-Ala-Arg O Met-Arg-Phe-Gly O Phe-Ala-Lys-Pro O None of these.
QUESTION 17 OL NEere interested in generating a PCR amplicon including the bracketed sequence below. Which of the following sequences would be canen hybridizing (annealing) with the target AND would also serve to generate a copy of the bracketed region of interest? 5'-AATCGT[AGCAGCAGCAGTGGCT]A AGCT-3 3' -TTAGCA[TC GTC GTC GTC ACC G A] TTCG A - 5' 3-TTAGC-S S-AATCG-3 OSAAGCT-3 5-AGCTT-3 5-GCTAA-3 5-TCGAA-3 QUESTION 18 Vhich of the following is/are true regarding the enzvme PRIMASE? Save and Submit to save and submit. Click Save All Answers to save all answers.
Question 7 (2 points) Determine the matching base pairs that RNA polymerase would lay down for this DNA sequence: TGCAGACT *record your answer with no spaces, dashes, or other characters
QUESTION 5 Shown here is a DNA sequence. The promoter is highlighted in yellow and the terminator is highlighted in blue. Transcription begins 10 bases from the promoter. The C marked with a heart is replaced by a A. What kind of mutaiton is this? 5'-ATATTTGCTAGACTGTCGCTCCGATCTGTACTTGATGCGATTČGGATCCCCGCTCCGATCGTAGGAGATTGCTGTTTTAC-3' 3'-TATAAACGATCTGACAGCGAGGCTAGACATGAACTACGCTAAGCCTAGGGGCGAGGCTAGCATCCTCTAACGACAAAATG -5' Promoter Terminator Silent O Missense O Nonsense O Frameshift
Question 17 What is the nucleotide sequence of the DNA strand that is complementary to 5'-ATCGCAACTGTCACTA-3 A 5'-UAGUGACAGUUGCGAU-3' B 5-TAGCGTTGACAGTGATA-3 5'-ATCACTGTCAACGCTA-3 D 5'-TAGTGACAGTTGCGAT-3'
QUESTION 4 Shown here is a DNA sequence. The promoter is highlighted in yellow and the terminator is highlighted in blue. Transcription begins 10 bases from the promoter. The A marked with a star is replaced by a T. What kind of mutaiton is this? 5'-ATATTTGCTAGACTGTCGCTCCGATCTGTACTTGATGCGATTČGGATCCCCGCTCCGATCGTAGGAGATTGCTGTTTTAC-3' 3'-TATAAACGATCTGACAGCGAGGCTAGACATGAACTACGCTAAGCCTAGGGGCGAGGCTAGCATCCTCTAACGACAAAATG -5' Promoter Terminator O Silent O Missense O Nonsense O Frameshift