QUESTION 4 Which length of DNA fragment would move the fastest and farthest during an electrophoresis run? O 750 base pairs (bp) O 1200 b O 300 bp O impossible to tell; depends on the actual sequence.
Q: Instructions Your task in this section is to build a bacterial replisome at the replication fork. Dr...
A: DNA replication is the process, where DNA is replicated using its own machinery. DNA replication is ...
Q: Samples Absorbance undiluted 0.715 1:4 dilution ratio 0.447 1:9 dilution ratio 0.321 a. Calculate th...
A: From the given BSA standard absorbance data, I have plotted above linear XY graph and derived Y=mx+C...
Q: This molecule `NH `NH can form 3 hydrogen bonds in base pairing B forms uridylate with ribose and ph...
A: Uridylate is the conjugate base of 5′-uridylic acid (Uridine monophosphate (UMP). This nucleotide th...
Q: what substances interfere with the tests for fructose? for lactose?
A: Seliwanoff's test is the qualitative test for the detection of ketose sugars in a sample. The ketose...
Q: how does the molecular basis of antigenic variation used by the trypanosome parasite makes the produ...
A: Antigenic variation is a powerful survival strategy adapted by certain species of parasitic protozoa...
Q: 8.The only imino acid a. Gly b. Cys c. Lys d. Pro
A: “Since you have asked multiple question, we will solve the first question for you. If you want any s...
Q: Choose one example of a carbohydrates with a chiral carbon and draw its Fisher's and Haworth's struc...
A: Carbohydrates are classified as monosaccharides, oligosaccharides, and polysaccharides based on the ...
Q: Why is it unfavorable for RNA molecules to adopt a double-helix structure similar to B-DNA?
A: The answer of the following question is given below
Q: Imagine that you are a cell with 88 chromosomes undergoing meiosis How many chromosomes would your d...
A: The answer of the following question is given below
Q: Enzymes normally enhance the rates of biochemical reactions by preferentially binding and stabilizin...
A: ATP synthase is an enzyme which form ATP by using ADP and Pi as the substrates. The enzyme is locate...
Q: What sugar units make up the structure shown? ÇH,OSO,- Но Lo- H. H. ÇOO- NHCCH, OH H H он
A: Carbohydrate consists carbon, hydrogen and oxygen. It is of different types like monosaccharides, di...
Q: Which test can be used to differentiate maltose and sucrose? Molisch Test Seliwanoff’s T...
A: Molisch Test : Detection of carbohydrates Seliwanoff’s Test : Distinguishes between ketose, aldose ...
Q: Assume that mitochondria contain 0.23 Molar KCL and 0.010 Molar NaCl. Calculate the grams per liter,...
A: KCl will dissociate into K+ and Cl-. However, NaCl will dissociate into Na+ and Cl-. Therefore, both...
Q: Explain in a more clinical detail the mode of actions of the following on the human skin cell or tis...
A: “Since you have asked multiple questions, we will solve the first question for you. If you want any ...
Q: Identify things in your house that contain macromolecules. Write down the name and its use as a prod...
A: Macromolecules- Large molecules divided into various classes like the carbohydrates, proteins and li...
Q: 17.1
A: Proteins are classified into two types Globular proteins and fibrous proteins. Proteins have f...
Q: How does the ionization state of amino acids vary with pH?
A: The ionization state of the amino acids mainly depends on the medium in which they are placed. The c...
Q: A trisaccharide was isolated from a new species of red algae. The sample was hydrolyzed and monosac...
A: Saccharides are the sugar molecule, which forms glycosidic bonds to give disaccharide or or tri or t...
Q: TRUE OR FALSE a) The structure of the purines and pyrimidines make them able to undergo keto-enol t...
A: The structure of the purines and pyrimidines make them able to undergo keto-enol tautomerism.
Q: What is Glycated Hemoglobin? What is the normal level of Glycated Hemoglobin?
A: Glycated Heamoglobin: A glycosyated hemoglobin test measures the amount of glucose ( sug...
Q: Which of the following is the result of the hydrolysis of 5'-CTAGTTC-3' at the b side?
A: Nucleic acids are polymers of nucleotides (which consist of phosphate group, sugar and nucleobases)....
Q: What would be the difference in oxygen availability in a beaker versus an inverted test tube when de...
A: The answer of the following question is given below
Q: The diameter of a white blood cell is 16µm. Determine the diameter of the cell in cm and inches. If ...
A: Metre is the unit of length in the International System of Units (SI system) and is represented by t...
Q: | Conc. H,SO, a-naphthol |(*) Conc. H,S0, acetic anhydride Orcinol, FeCl, HCI A () c (*) (-) Cu(CH,C...
A: This experiment shows testing of a mixture of carbohydrate/sugar In Step 1: Reagent used in Conc H2S...
Q: What is an example of an unusual base pair interaction that is found in RNA but not DNA? 1. G-U ...
A: RNA is composed of nucleotides attached together via phosphodiester bonds. DNA is also composed of n...
Q: part 1 A young athlete has trained over several months to participate in a duathlon sprint. They are...
A: Hello! Thank you for the questions. As you have posted multiple questions, I would be answering the ...
Q: Lowering the water activity of a food will inhibit the growth of microorganism in which of the follo...
A: Enzymes are usually made of globular protein molecules that increase the rate of reaction without be...
Q: Kindly answer numbers 12, 13, and 14 12. This protein that is involve in immune system responses is...
A: Note - Hi ! Thank you for the question. We are authorized to answer one question at a time. Since yo...
Q: Question 7 The uncoupling agent 2,4-dinitrophenol (DNP) has a pk, of about 7.2. Which of the followi...
A: Uncouplers are the compounds that interact with electron transport chain and inner mitochondrial mem...
Q: Cellobiose is identical with maltose except that the former has a β-1, 4-glycosidic linkage True ...
A: Carbohydrates are biomolecules with both great structural and functional diversity. Due to the prese...
Q: Please help a bit confused
A: STR is defined as the Short tandem repeats, also known as microsatellites or simple sequence repeats...
Q: Can you help find the c terminal at ph 9.5?
A: The given hexapeptide is composed of serine, histidine, glutamate, cysteine, arginine, and glutamine...
Q: *H3N -Č-H CH2 он Tyrosine Draw the structures of tyrosine as different pH values. Please refer to th...
A: Ionization state of any amino acid is decided by its pKa value and pH of solution. pKa and pH both a...
Q: H C-H O: H- OH HO H- C OH H C-H OH Which of the following best describes the saccharide shown? a mon...
A: Sacharides are defined as sugar molecules which are nothing but carbohydrates. The sacharides are cl...
Q: essential fatty acids
A: Essential fatty acids are essential unsaturated fats that are necessary for human health but our bod...
Q: How do you think AMPK helps the athletes on achieving the "unexpected sudden strength" during high i...
A: AMPK- AMP-activated protein kinase AMPK - Gets regulated by adenosine monophosphate (AMP) and adenos...
Q: A double helix makes one complete turn every 10 residues (3.4nm). Therefore the distance between bas...
A: The answer of the following question is given below
Q: Can you please help find the place value for T state?
A: Proteins are a type of macromolecule that serve a variety of roles in the cell. They assist metaboli...
Q: Given the electrophoresis profile of a Sanger sequencing result, what was the sequence of the origin...
A: Sanger sequencing method is also called as chain termination method. In this method dideoxy NTP is u...
Q: Discuss shortly the main differences among the different types of carbohydrates (monosaccharide, dis...
A: Carbohydrates are the biomolecules that are made upbof Carbon, hydrogen and oxygen. The general form...
Q: Q15) The pathway below is an anabolic pathway, where it is thought that products D and E are essenti...
A: Enzymes are biocatalysts which increase the rate of biochemical reactions. Enzymes help to attain th...
Q: The following sattements are true for glycogen. EXCEPT: Branching of α(1→6) linkages every 8-1...
A: Glycogen can be defined as a multibranched polysaccharide. It functions as a storehouse of energy in...
Q: 13
A: 20:2 Delta 4,9 fatty acid It means fatty acid with 20 carbons and 2 double bonds at 4th , 9th carbon...
Q: 5' C A G In the reaction shown, O a phosphoanhydride bond is broken and a phosphate ester bond is fo...
A: A phosphodiester bond occurs when two of the hydroxyl groups in phosphoric acid react with hydroxyl ...
Q: The “spikes” in the COVID-19 virus are protein complexes. How important are these spikes in virus i...
A: SARS-CoV-2 is a single-stranded RNA-enveloped virus and a large number of glycosylated spike (S) pr...
Q: You have PGFPuv at 75ng / uL You need 1.15 ng total DNA in a final volume of 30 . Calculate how much...
A: pGFPuv encodes a green fluorescent protein (GFP) variant from Aequorea victoria that has been engine...
Q: True / False: β-bends can link together α-helices and β-sheets.
A: Proteins are the end products of a decoding process that begins with cellular DNA information. Prote...
Q: . What is the purpose of fixation in cytological staining?
A: Tissue fixation is a critical step in the preparation of histological sections for staining microsco...
Q: Which of the following is the correct glycosidic bond linkage of the disaccharide shown? OH HO но Он...
A: Glycosidic linkage is formed between sugar molecules. The monosaccharide units are joined together t...
Q: Malonate is a competitive inhibitor of succinate dehydrogenase. What citric acid cycle intermediate...
A: Aerobic metabolism is a set of three basic metabolic processes that occur in cells to generate energ...
Trending now
This is a popular solution!
Step by step
Solved in 2 steps
- Numbering the fragments left by cutting the DNA with BAM HI from left to right, which fragment will travel the furthest? BAM HI: GGATCC CCTAGG AATCGGATCCATTTGGACTAAAGGACCCGGATTGGATCCAGGGCCTTTAGTACC TTAGCCTAGGTAAACCTGATTTCCTGGGCCTAACCTAGGTCCCGGAAATCATGG O 3 O 2 4. 1.Why is the company Qiagen has more refined DNA extraction steps than a normal Strawberry DNA extraction practical? Summary of Qiagen DNA extraction steps Add ATL buffer and grind with sample. Add 20 microliters of enzyme Proteinase K to degrade protein into a 1.5-2ml microcentrifuge tube. Add 200 microlitres AL lysis buffer, and mix by vortexing for 5–10 seconds, which breaks cell membrane allowing DNA to be released. Incubate the sample at 56 degrees for 10 minutes. Mix the cell lysate with 200 microlitres ethanol by pipetting it at the side of the microcentrifuge wall so DNA precipitates. The DNA forms a white layer and the remaining liquid is discarded. Pipet the mixture into DNeasy Mini spin column placed in a 2 ml collection tube. Centrifuge for a minute at 8000 rpm. Place the mini spin column into a 2 ml collection tube, add 500 µl Buffer AW1, and centrifuge for 1 min at 8000 rpm. Then add it to a new 2 ml collection tube (provided), add 500 µl Buffer AW1, and centrifuge for 1…Which of these is not a tool for comparing DNA sequences? O PLINK Fasta BLAST A dotplot e.g. dotlet
- DNA Replication, Sequencing, and Recombination - PowerPoint Karla Henthorn KH Animations Slide Show Review View Help O Tell me what you want to do A A E. s et Direction- Align Text Shape Fill O Find US abs AV- Aa - ay. A- Stiape Outine- ab Replace- ne Arrange Quick Styles Convert to SmartArt Shape Effects A Se Font Paragraph Drawing 6 5 4 1 3 Ec 2 1 2 3 H4 Kim ACTIVITY Consider the following DNA molecule: ACG GTACACTTA C G A A Henthorn, ic T GCCAT GT GA ATG CT T Rc 1) Draw the 2 strands after they have "unzipped". 2) Follow the rules for pairing and fill in the new strands with the correct nitrogenous bases. Write these new strands in a different color of ink. = Notes Comments 可 DO DELLFor a DNA sample, the OD value at 260nm = 0.125, and the OD value at 280nm 0.065. Purity of DNA - OD 260/280 %3D Concentration of DNA = Abs x 50 µg/ml x dilution factor (100) 0.125 x 50 µg/ml x 100 = Edit View Insert Format Tools Table 12pt v Paragraph v BIUA 2 T'vCan you explain thie each of the statement given i dont really understand the dna recombinant is used as a molecular cloning and application for recombinant dna
- DNA is visualized during agarose gel electrophoresis by ______________ . the fact that DNA fluoresces when illuminated with UV light the binding of a fluorescent dye that is easily detectable using radioactive antibodies that specifically bind to DNA the fact that DNA is blue and can be seen when millions of copies are present in a bandt (5 a 1 dao) - Google Chrome edu.om/mod/quiz/attempt.php?attempt=2334320&cmid=1127808 SQU E-LEARNING SYSTEM (ACAI الوقت المتبقي 0.175mm .e O In the DNA extraction experiment, the separation of DNA from its packaging protein can be achieved by the addition of Detergent aO 1.00 Salt b O هذا السؤال Ethyl alcohol cO Papain powder .d O Cold water Le O In paramecium, osmoregulation occurs through 3 Activate Windowssk Macronucleus Goaotings to acttivate do nere to search 6. 70°F Mostly sunny 9:05 ENG 12/18 f2 O f3 O f4 O f6 O f8 end f7 0 F10 insert f9 D F12 T num IA break @ %24 & 8 2 3 r 4 5 6 7 8 A 9 9 R Y ! U S F G J K +|| 回 Q 以 4Formation ofa recombinant DNA molecule. GAATTC GAATTC CITAAG CITAAG double-stranded DNA DAATTO DAATTO CTTAA OG CTAA AATT GI AATT CTTAA GAARIC CTTAAG The enzyme that cataly zes the joining of fragments to form recombin ant DNA is: DNA polymerase DNA ligase helicase re striction endonuclease
- - Addin X O Informational Rese X E credible source act X Y Muhammad | Biogr X W Muhammad - Brita X mi.instructure.com/courses/25527/assignments/4743473 Due Wednesday by 11:59pm Points 100 Submitting an external tool Your progress has been saved Question 1 of 9 Which of the following statements are true about DNA polymerase? Select all that apply. O On the leading strand, it works toward the replication fork. O It adds nucleotides from the 5' end of the DNA toward the 3' end. O On the lagging strand, it works away from the replication fork. O It starts replication at one end and then switches sides and continues on to the other strand. « PreviousDuring electrophoresis, DNA molecules can easily be separatedaccording to size because all DNA molecules have the samecharge–mass ratio and the same shape (long rod). Would youexpect RNA molecules to behave in the same manner as DNAduring electrophoresis? Why or why not?all 224 811 468 61+ Time left •;•o Question IP Not yet answered Marked out of •.IFY Flag question What would be the effect on the PCR reaction if any of the following circumstances arose: 1) there are no primers in the reaction, Y) there are no DNTPS in the reaction, P") there is no Taq polymerase in the reaction? a. The reaction will cease after a few cycles b. The PCR reaction will not commence O c. PCR would proceed normally d. Non-specific PCR of random templates will occur