The following DNA sequence is at the start of a DNA strand: 3'—AATTCGAGATTCA—5'. Which of the primer sequences below would be synthesized from this strand by DNA primase to initiate DNA replication? Group of answer choices a 3'—TTAACGTCTAAGT—5' b 3'—UUAAGCUCUAAGU—5' c 5'—TTAACGTCTAAGT—3' d 5'—UUAAGCUCUAAGU—3'
Q: Which of the following strands of DNA always has the same sequence (except T-> U) as its…
A: In genetics,a sense strand or coding strand is the segment within double stranded DNA which carries…
Q: Given a part of DNA undergoing replication. Copy and write the corresponding bases in the new…
A: Semiconservative mode of DNA replication describes the mechanism of DNA replication in all living…
Q: Which dna strand will be synthesized continuously during dna replication? a.The strand that is…
A:
Q: If a segment of DNA is 5'CATTAC—3', the complementary DNA strand is (a)3'—CATTAC—5'(b) 3'—GTAATG—5'…
A: All living organisms store their genetic information in form of DNA / RNA. This genetic information…
Q: Which of the following sequences would be complementary to a DNA strand with the sequence…
A: Complementarity refers to a relationship between two structures each following lock and key…
Q: A DNA strand has the following sequence: 5′–GATCCCGATCCGCATACATTTACCAGATCACCACC–3′In which…
A: DNA( deoxyribonucleic acid) is the double-stranded molecule that is the genetic material in most…
Q: If a strand of DNA has the sequence CGGTATATC, then the complementary strand of DNA has the sequence…
A: Every living organism has Deoxyribonucleic acid (DNA). DNA has a recipe for synthesizing proteins.…
Q: The following is a section of DNA removed from a cell nucleus: 5'…
A: The basic physical and functional unit of heredity is the gene. DNA is the material that makes up…
Q: Which letter(s) represent the 3' end of the DNA molecule? You can choose more than one answer. B…
A: which letter represent the 3' end of the DNA molecule you can choose:
Q: Which of the following represents a missense mutation in the DNA coding strand sequence, 5' -…
A: A change in the structure of DNA, known as a mutation, can alter the sequence of amino acids that…
Q: Write the sequence of the complementary strand of each segment of a DNA molecule. a. 5 '–AAATAAC–3…
A: Since you have posted a question with multiple sub-parts, we will solve the first three subparts for…
Q: Two base pairs of double-stranded DNA are shown in the figure. Use your knowledge of base structure,…
A: DNA In DNA there are 4 bases Adenine, Thymine, guanine and cytosine. Adenine binds with Thymine…
Q: DNA replication is said to be semiconservative because a. one of the new molecules conserves both of…
A: DNA( deoxyribonucleic acid) is the double-stranded molecule that is the genetic material in most…
Q: If a sequence of one strand of DNA is 5'-TGACTATC-3', what is the complementary strand?…
A: DNA is a macromolecule and is composed of two complementary strands. Bonds which is formed between…
Q: Determine the complementary strand of DNA that forms on this template DNA fragment during…
A: The complementary strand of the DNA fragment during the replication : 3' CCAAAGAAGTTCTCT 5'
Q: Which of the following is not a feature of eukaryotic DNA replication? a. Replication bubbles move…
A: DNA (deoxyribonucleic acid) is the genetic material of an organism. The specific nucleotide sequence…
Q: DNA replication is said to be semiconservative becausea. each new DNA molecule contains one new…
A: DNA replication is the process of generating two same replicas of DNA from one original DNA.
Q: In the lagging strand, DNA is made in the direction _________ the replication fork and is made as…
A: The DNA replication is the process by which the genetic material of the organism copies itself to be…
Q: DNA Template: AAC CGA TCC TAT CGG AAA TTT TGC ATG ATC TAT Give the nucleotide sequence after DNA…
A: The replication is the process of new DNA synthesis from the old DNA. The transcription is the…
Q: In the diagram of replication shown here, fill in the blanks with the appropriate terms: (a) base…
A: Transmission of chromosomal DNA from generation to generation is crucial to cell propagation. This…
Q: Which of the following is the correct way that a polynucleotide chain is put together in one DNA…
A: DNA is a polynucleotide. It is a polymer of nucleotides. The individual nucleotides are joined by…
Q: DNA replication occurs by adding (Note: NTPS = nucleotide triphosphates; dNTPs = deoxynucleotide…
A: Replication of DNA, the genetic code carrier molecule of the cell is an essential process in cell…
Q: If a protein was made up of 12 amino acids, how many nucleotides would make up the DNA message…
A: DNA( Deoxyribonucleic acids) is made up of two polynucleotide chain that winds around each other and…
Q: Which model accurately represents the semi-conservative nature of DNA replication? Figure A Figure…
A: Semiconservative mode of DNA replication means half conserved DNA synthesis.
Q: The DNA strand whose complementary RNA contains a stop codon starting at the 5' end DNA A = 5'…
A: In our body genetic information is stored in form of DNA. DNA can be converted to RNA by…
Q: One half of a DNA strand has the following sequence of bases GCTACGGCGTTATCCCC. What would appear on…
A: In a DNA molecule each deoxyribonucleotide is made up of a sugar, nitrogenous base and phosphoric…
Q: Which of the following double stranded DNA molecules would require the most amount of energy to…
A: DNA( deoxyribonucleic acid) is the double-stranded molecule that is the genetic material in most…
Q: Which of the following steps in DNA replication would occur second? 1.DNA molecule separates into…
A: Replication occurs in three major steps: the opening of the double helix and separation of the DNA…
Q: Which process in protein synthesis is most affected by a silent mutation? Select one: a. Replication…
A: Silent mutation are essentially base replacements that outcome in no difference in the amino acid or…
Q: Just prior to DNA replication the cytosine in the sequence GTTCATTG is deaminated and it is not…
A: The deamination means removal of the amino group (-NH2) from a particular molecule. In the cell…
Q: E.coli is replicating its chromosome. If the template DNA sequence is: 3' AAA CGC GAT 5', what would…
A: DNA and RNA are nucleic acids present in the organisms. DNA is the deoxy ribose nucleic acid whereas…
Q: Using the following DNA sequence what would be the complementary DNA made during replication? TAC…
A: Complementary DNA is synthesized from a mature mRNA strand and it lacks both promoters and introns.…
Q: From which end of a strand of nucleic acid does DNA polymerase I REMOVE nucleotides? A) 5' B) 3'…
A: DNA polymerase 1 has three types of polymerase activity. 1. 5'-3' polymerase activity- It is…
Q: A student mixes various molecule needed for DNA replication. When he adds DNA, replication occurs,…
A: DNA is a double helix structure that is made up of two anti-parallel strands of a polynucleotide…
Q: Label all of the lettered components (A through H) in the figure of DNA replication below. C A G E
A: Replication is the process in which a double-stranded DNA molecule is copied. It is copied to…
Q: Which of the following statements is true about DNA? Select one: O a. The two strands of DNA are…
A: The DNA molecule is a polymer of nucleotides. Each nucleotide is composed of a nitrogenous base, a…
Q: Below is a figure representing DNA replication. One end of the DNA is labeled; given this…
A: * DNA replication is a process in which double stranded DNA molecule is copied and hence produce…
Q: Number the steps of DNA replication in the correct order (1, 2, 3) a) ______ Polymerase travels down…
A: Correct order is 1.)- b. 2.)-a. 3.)-c
Q: Draw the steps of DNA replication. Use the following nucleotide sequence as reference: 5’ C C T A…
A: Introduction A double-stranded DNA molecule is replicated during replication to create two identical…
Q: Which of the following statements is/are TRUE for DNA Replication? Two daughter DNAs are formed,…
A: DNA replication is a process by which 2 copies of DNA are produced from a DNA double helix using…
Q: If the sequence of one strand of DNA is CTCGGA, the sequence of the complementary strand will be…
A: DNA has two strands that are antiparallel and complementary to each other. Antiparallel means that…
Q: S ..GACTAAGGCTTAGS CTGATieCGAATGS .CTGATTCCG AA TG 5 NEW STRANDS (Fill in the correct bases and…
A: DNA is the genetic material of a cell that carries hereditary information required for the survival…
Q: Illustrate some steps involved in DNA replication :Suppose the following base sequence was found in…
A: "Since you have posted a question with multiple sub-parts, we will solve the first three sub-parts…
Q: 14
A: DNA replication is a process in which a single DNA molecule under goes replication and produces two…
Q: If the template DNA sequence is 3' - CCC - ATA - GAG - AAA - 5' , then what is the corresponding…
A: DNA is molecule which is present inside a cell and contain the genetic information of an individual…
Q: In DNA replication, which daughter strand is more likely to have a mutation? Select one: O a.…
A: DNA replication occurs differently in two different strand of DNA. The replication process in…
Q: A portion of one strand of DNA has the sequence 5′ ATTCGGTAA 3′. If this strand is used as a…
A: Since you have asked multiple question, we will solve the first question for you. If you want any…
Trending now
This is a popular solution!
Step by step
Solved in 3 steps
- The phrase 5to3 refers to the _________ . a. timing of DNA replication b. directionality of DNA synthesis c. number of phosphate groups1 a)The nucleotide sequence below is one half of a double stranded DNA sequence. The highlighted portion of the sequence is where a primer will bind during DNA replication. Which of the following options best represents the primer? 3’ – GCTCGACGTTCTGCGCTGTCGGGCTATGCG – 5’ a. 3’ – CGCATAGC – 5’ b. 3’ – CGCAUAGC – 5’ c. 3’ – CGUCGAGC – 5’ d. 3’ – CGUCGAGC – 5’ e. None of the above b) Which one of the following statements is true? a. The lac repressor and catabolite activator protein are both controlled by allosteric binding b. The addition of substrate to a non-competitive inhibition reaction will repress the inhibitor c. The lac repressor is inhibited by lactose through competitive inhibition d. β-galactosidase will hydrolyze galactose to form glucose and lactose e. The x-intercept of a Lineweaver-Burk plot is the numerical value for the maximum reaction velocityWrite the complementary strand to the following single-stranded DNA and label the 5' and 3' ends: 5'-ATAGCATGGGCCATACGATTACTGA-3'
- (3) A DNA strand is 5' TAC ACG GTC TAA3' Write the RNA strand that could be made from the DNA strand. Indicate the 5' and 3' endsGive the sequence of the complementary DNA strand for the DNA chain with the following base sequence5'-CTTGGATATC-3'Fill in the palindromic sequence of the given DNA strand containing six bases. 5' GACGTC 3' 3' _ _ _ _ _ 5'
- Draw the steps of DNA replication. Use the following nucleotide sequence as reference: 5’ C C T A T G C A G T G G C C A T A T T C C A A A G C A T A G C 3’A region of DNA has six copies of a trinucleotide repeat. During one round of replication, the template strand slips as shown in the diagram. How many repeats will the DNA have if the newly synthesized strand is used as a template in the next round of replication? 1 5'-CAG 3'-GTC GTC 4 2 GTCH 3 2 CAG CAG GTC 3 GTC 5 4 CAG-3' GTC -5' 6 Next round of DNA replicationCreate the RNA strand to be synthesized from the DNA double strand below and explain this synthesis, including the functions of the molecules responsible for synthesis. 5’-ATCGCTTGTTCGGAA-3’ 3’-TAGCGAACAAGCCTT-5’
- What would be the complementary strand of DNA below? 3’-ACGTGCTACGGTACG-5’During DNA replication, a template strand is used to synthesize a new "daughter" strand of DNA. Below is a sequence of a short segment of DNA. Provide the base sequence in the complementary strand and label all ends. 5’ A A T C G T A A G C T 3’Give the DNA compliment to the following DNA strand. GTA SMH UUU GUA CAT