The following is a section of DNA removed from a cell nucleus: 5' ATGAAATAATCAGTTAACAGCAGVFCCGATTTTTATACT 3'strand 3' TACITTATTAGTCAAVFGTCGTCAAGGCTAAAAATATGA 5'strand a. What does the Central Dogma state? b. Label the strands above as the "sense" or "antisense" strand. c. Using the chart below, transcribe ONLY the gene into mRNA and then translate the gene into its amino acid sequence, d. What would happen to the gene if the adenosine mutates to a thymine where the arrow indicates? 3' TACTTTATTAGTCAATTGTCGTCAAGGCTAAAAATATGA 5' What type of mutation is this?
The following is a section of DNA removed from a cell nucleus: 5' ATGAAATAATCAGTTAACAGCAGVFCCGATTTTTATACT 3'strand 3' TACITTATTAGTCAAVFGTCGTCAAGGCTAAAAATATGA 5'strand a. What does the Central Dogma state? b. Label the strands above as the "sense" or "antisense" strand. c. Using the chart below, transcribe ONLY the gene into mRNA and then translate the gene into its amino acid sequence, d. What would happen to the gene if the adenosine mutates to a thymine where the arrow indicates? 3' TACTTTATTAGTCAATTGTCGTCAAGGCTAAAAATATGA 5' What type of mutation is this?
Medical Terminology for Health Professions, Spiral bound Version (MindTap Course List)
8th Edition
ISBN:9781305634350
Author:Ann Ehrlich, Carol L. Schroeder, Laura Ehrlich, Katrina A. Schroeder
Publisher:Ann Ehrlich, Carol L. Schroeder, Laura Ehrlich, Katrina A. Schroeder
Chapter13: The Endocrine System
Section: Chapter Questions
Problem 41LE
Related questions
Question
The following is a section of DNA removed from a cell nucleus:
5' ATGAAATAATCAGTTAACAGCAGVFCCGATTTTTATACT 3'strand
3' TACITTATTAGTCAAVFGTCGTCAAGGCTAAAAATATGA 5'strand
a. What does the Central Dogma state?
b. Label the strands above as the "sense" or "antisense" strand.
c. Using the chart below, transcribe ONLY the gene into mRNA and then translate the gene into its amino acid sequence,
d. What would happen to the gene if the adenosine mutates to a thymine where the arrow indicates?
3' TACTTTATTAGTCAATTGTCGTCAAGGCTAAAAATATGA 5'
What type of mutation is this?
Expert Solution
This question has been solved!
Explore an expertly crafted, step-by-step solution for a thorough understanding of key concepts.
Step by step
Solved in 2 steps
Knowledge Booster
Learn more about
Need a deep-dive on the concept behind this application? Look no further. Learn more about this topic, biology and related others by exploring similar questions and additional content below.Recommended textbooks for you
Medical Terminology for Health Professions, Spira…
Health & Nutrition
ISBN:
9781305634350
Author:
Ann Ehrlich, Carol L. Schroeder, Laura Ehrlich, Katrina A. Schroeder
Publisher:
Cengage Learning
Medical Terminology for Health Professions, Spira…
Health & Nutrition
ISBN:
9781305634350
Author:
Ann Ehrlich, Carol L. Schroeder, Laura Ehrlich, Katrina A. Schroeder
Publisher:
Cengage Learning