Use the picture below to answer the question. Coastal Bay Food Chain Algae Barracuda Damselfish Zooplankton Shrimp This food chain can be found in the coastal waters of Virginia. The population of which organisms in the food chain would be the next to decline if commercial fishing over-harvested shrimp and the shrimp population decreased? Be sure to support your reasoning with evidence from the diagram. Please write in complete sentences.
Q: What is the role of a virus in gene therapy? O t carries the faulty DNA out of the patient's cells. ...
A: Given: Much attention has, been focussed on the so called genetic metabolic diseases in which a defe...
Q: [ Select] are to water transport, as [ Select ] are to nutrient [ Select 1
A: Xylem is for water transport. Xylem is the tissue that is involved in transport of water and dissolv...
Q: Explain the importance of natural pigments in fruits and vegetables
A: Answer : The importance of pigmentation in fruits is that the pigmentation plays an important role i...
Q: Explain in detail Structure , reproduction and life cycle of mucor .
A: Structure:- Mucor's vegetative structure:- Multicellular fungi, such as Mucor, are organized into ...
Q: D. melanogaster
A: melanogaster, has been heavily used in research in genetics and is a common model organism in develo...
Q: B. Make a punnet square for the following and give the phenotypic and genotypic ratio: 1. One homozy...
A: Answer 1:- A monohybrid cross is a breeding experiment between organisms of the P generation (paren...
Q: What are some research-able questions about Climate Change?
A: Climate change is a broad area of research and there are always a huge number of topics. Some of my ...
Q: . In pea plants, flowers can be purple (dominant allele, A) or white (recessive allele, a). If 75% o...
A: In pea plants, the dominant allele (A) gives flowers a purple color in both homozygous and heterozyg...
Q: Both ocelli and statocysts are composed in part of nerve tissue. True False
A: Answer : Both ocelli and statocysts are composed in part of nerve tissue. false.
Q: 1. IDENTIFY THE BASIC TYPE OF EPITHELIUM. 2. GIVE THE SPECIFIC NAME OF THE EPITHELIUM. 3. IDENTIFY T...
A: A stratified squamous epithelium is a flattened epithelial tissue that are arranged in layers over a...
Q: 1. What does NADPH do? In the Krebs cycle, isocitrate releases a molecule of carbon dioxide, leaving...
A: Introduction Photosynthesis is the process through which plants produce oxygen and energy in the for...
Q: a paragraph, describe the feedback mechanism that happens in the femaile reproductive system
A: Answer
Q: The coding DNA strand of a gene has the following DNA sequence: 5' ATGGCGACGATAATGTTGTGTGAGTGA 3' 1)...
A: Central Dogma: It is the complete procedure of replication, transcription, and translation of DNA. T...
Q: Which of the following is an accurate model and description of anaphase II in Cape parrots?
A: As per the Karyotype of the somatic cells from the cape parrots obtained, they have total 29 pair of...
Q: Compare Class Merostomata and Class Pycnogonida
A: Merostomata is a name given to the now extinct sea scorpions or can be said Eurypterida and the hors...
Q: Specify the correct number of chromosomes and chromatids in each of the following human cell types. ...
A: Introduction: When a cell prepares for division, It makes a new copy of the DNA. The one half of th...
Q: Complete the energy pyramid by writing the source of the energy for the food web and how much energy...
A: Introduction An organism's trophic level is the position it holds in a food chain. A food chain is a...
Q: forms protective outer layer of skin [ Choose ] [Choose ] bone forms kidney tubules simple cuboidal ...
A: ANSWERS
Q: 3. In a plant population you identify and mark newly emerged seedlings in the spring. At the end of ...
A: The Hardy–Weinberg principle, also known as the Hardy–Weinberg equilibrium, model, theorem, or law i...
Q: Water is important for all living organisms. The functions of water are directly related to its phys...
A:
Q: 1999 Question #2 Communication occurs among the cells in a multicellular organism. Choose three of t...
A: Introduction A cell's ability to receive, process, and transmit messages with its surroundings and w...
Q: Why overwatering of plants results in yellowing of leaves
A: Introduction:- Plant growth is influenced by a variety of factors. Plants are sensitive to temperatu...
Q: Why "cellulose is composed of a long, branced chain of B-glucose subunits" is false?
A: Introduction Polysaccharides, also known as polycarbohydrates, are the most common type of carbohydr...
Q: 1999 Question #2 Communication occurs among the cells in a multicellular organism. Choose three of t...
A: A... Communication between two plant cell.. cell to cell communication. Through the plasmodesmata. B...
Q: Watson and Crick used scientific reasoning, their knowledge of biochemistry, and the research of oth...
A: Many people believe that DNA was discovered in the 1950s by James Watson, an American biologist, and...
Q: Compare and contrast preimplantation genetic diagnosis and genetic testing.
A: Pre-implantation genetic diagnosis (PGD) is commonly described as the examination of embryos or oocy...
Q: A scientist studying a species of algae, Gracilaria domingensis, discovered that its color is contro...
A: Alleles can be described as the different forms associated with particular gene. The formation of ge...
Q: The force causing air to flow into the lungs during ventilation is: Decreased lung pressure Increase...
A: Air flows inside and outside the lungs die to the pressure difference in atmosphere and inside lungs...
Q: Consider Mendelian traits versus polygenic traits. What impact do modifications, such as those offer...
A: CRISPR-Cas9 has recently become a popular set of tools for genetic engineering. By targeting specifi...
Q: You are attempting to rupture cells. You systematically dilute a lysis buffer of ammonium sulfate in...
A: The term molarity is associated with the number of solute molecules present in a solution in one lit...
Q: discuss comprehensively Distinguish between simple and complex carbohydrates.
A: Carbohydrates are the rich energy source synthesized in the process of photosynthesis. Carbohydrates...
Q: Match each of the follwoing
A: In 1961, Matthaei became the first to describe the structure of a codon. tRNA is a literal "adaptor"...
Q: Suggest some making decisions and designing genetically modified organisms.
A: Genetically modified organisms(GMO)are organisms that their DNA altered using genetic engineering te...
Q: the Chronic Myelogenous Leukemia (CML)
A: A disease in which the bone marrow makes too many white blood cells is known as the chronic myelogen...
Q: Give a new example of transgenic organism wherein i can generate desired characteristics of that cer...
A: Transgenic organisms can be produced through various mechanisms such as Transformation, Transfection...
Q: Which plant showed growth ? Why
A: Introduction Plant Hormones are also known as Phytohormones. Phytohormones are the signaling molecu...
Q: How is artificial selection different from Darwin's idea of natural selection?
A: The theory of natural selection was explored by 19th-century naturalist Charles Darwin.
Q: What are two examples of macro-molecules formed by dehydration synthesis ?
A: A macromolecule, such as a protein, is an extremely big molecule. They are made up of thousands of a...
Q: sequences oT two con the following bacterlal promoter. The startpoint of transcription is shown in r...
A: Transcription is the act of copying and interpreting information from a DNA strand into a new molecu...
Q: How do neurodegenerative diseases such as Alzheimer's and Parkinson's disease relate to the concept ...
A: Introduction :- The progressive loss of structure or function of neurons, known as neurodegeneration...
Q: Required information Genes A and B are close together on the same chromosome. The figure shows two A...
A: Crossing over is a process where the chromosomes exchange genes between them during sexual reproduct...
Q: Lipid-soluble molecules: O are considered polar molecules. O generally diffuse freely through the ce...
A: The correct answer is- generally diffuse freely through the cell membrane.
Q: List atleast 50 laboratory equipments or tools. Just list, no need to give the uses
A: ANSWER;- 50 laboratory is;-
Q: Spin 1.5 ml of cells in a microcentrifuge at maximum speed (12,000 rpm) for pellet. Remove the super...
A: To isolate plasmid DNA, cells are cracked open and a mini preparation should be performed, trying h...
Q: QUESTION 1 Atherosclerosis is caused by: O Lipids being transported in the blood Hypertension leadin...
A: High blood pressure or hypertension is a condition where pressure exerted b blood against the wall o...
Q: A 2 NATALIA JAi CLAUDE !al O, A AB AB (A B 5 JANE ii 6 8 MARK |Bi ii MIGUEL DAVID JAJB JAJB |Bi JANE...
A: Introduction: Pedigree analysis is the study of a particular trait that is inherited from one genera...
Q: t is 9 am in the morning and David has not eaten since dinner last night at 8 pm. He has fasted for ...
A: The dependent variable is the effect and it depends on other variables and changes as per the change...
Q: Activity 1.3: Complete the table. Directions: Explain and give application for each process/tools. P...
A: 1.Restriction enzyme Explanation- A restriction enzyme is a protein that recognises a specific, sho...
Q: According to Atterberg, between the ________________ and ______________ limits, a soil is in a plast...
A:
Q: DDE vs Eggshell Thickness 1.28 1.24 1.2 1.16 - 1.12 3 7 9 11 DDE concentration in egg (ng/g) Shell t...
A: Q-1): In birds, the process of bone remodelling plays a vital role in maintaining bone calcium level...
Trending now
This is a popular solution!
Step by step
Solved in 3 steps
- Use the igure below, which shows the Tood web of an aquatic ecosystem, to anSwer the following questions: Killer whale Crabeater seal Elephant seal Adelie penguin Squid Leopard seal Cod / small animals and protists Algae Use the figure below, which shows the food web of an aquatic ecosystem, to answer the following questions: CMAC 1-In the food web above, there are eight food chains that include krill. In the space provided, identify all of the organisms in the order in which they occur in three of these eight food chains Food chain 1 Food chain 2 Food chain 3 3- Identify the most energy efficient food chain for the killer whale. Food chain 3- Draw am energy pyramid for the most energy efficient food chain for the killer whale . 4 2 I 3.Based on the food chain shown below, how can unregulated collection of sharkfins used in shark fin soup cause the collapse of a coral reef ecosystem? To answerthis question, continue the trend in abundance of each species indicated in the graphprovided and explain your predicted trends. edit the picture pleaseFood webs are helpful diagrams to understand the relationships of organisms within a biological community. Answer the following questions using the food web below. Baleen whale Smaller toothed Sperm whale whales Penguins Elephant seal Leopard seal Other birds Fish Other seals Squid Krill Other herbivorous zooplankton Carnivorous zooplankton Phytoplankton Which of the following can be a secondary consumer? squid other seals krill herbivorous zooplankton fish other birds elephant seal
- Use the information and table to answer the following question. An ecologist is studying a population of mosquitos living in a nearby pond. The ecologist estimates the population size twice a day - once at sunrise and once at sunset - for 5 days during the summer when mosquitos are reproducing. Their data is shown. Based on the data, what is the estimated carrying capacity for the population and what factor may have led to a change in data at day three? a. The estimated carrying capacity is approximately 167 thousand. The population may have decreased during day three because of decreased pressure from a limiting factor such as reduction of predators eating the mosquitos. b. The estimated carrying capacity is approximately 188 thousand. The population may have decreased during day three because of decreased pressure from limiting factors, such as more food being available.c. The estimated carrying capacity is approximately 188 thousand. The population may have decreased during day…In not more than 200 words or 5 sentences, explain why or why not shark finning used in shark fin soup can induce the destruction of the coral reef ecosystem.Below is a list of the 9 organisms for this case study. Which of these organisms compete for space on rocks in the intertidal? Select all that apply. Meet the Players Primary Producers-Generate their own food using energy from the sun Common coral weed-Red Algae Nori seaweed-Red Algae Black pine Red Algae Sessile Consumers Acorn Barnacles Mussels Gooseneck Barnacles Mobile Consumers Dogwhelk Ochre Sea Star chiton O nori seasweed O black pine O common coral weed mussels acorn barnacles O gooseneck barnacles O chitons O ochre sea stars O dogwhelks
- Two species of sea urchins live practically side by side on sandy bottoms. The two species appear to have the same diet: drift seaweedsand other bits of organic matter. They are able to live in the sameenvironment with minimal competition. How might they be able toshare their habitat and food resources?Image Source Look at the picture above and read the explanation below. Then answer the questions below. This graphic shows both a healthy and an unhealthy fresh water stream that could appear in the headwaters of the Chesapeake Bay watershed. The graphic includes species that are characteristic of both healthy and unhealthy freshwater streams [...] in the Bay watershed. The left, "healthy" side of the graphic shows several macroinvertebrates, fish, birds, insects and vegetation that are indicative of a healthy freshwater system. Species shown are stonefly larva, caddisfly crayfish, devil crayfish, yellow lamp mussel, green floater mussel, muskrat, belted kingfisher, great blue heron, brown trout, striped bass, alewives, pumpkinseed fish, coontails, eelgrass, red maple tree, pine trees, and paw paw tree. [...] The right, "unhealthy" side of the graphic shows a murky, "dirty" freshwater system filled with nutrients, sediment, leaves, trash and sickly vegetation. In addition, dead…Food Chains and Food Webs INTERPRETING GRAPHICS Use the figure below, which shows the food web of an aquatic ecosystem, to complete items 1-7. Killer whale Crabeater seal Elephant seal Adelie penguin Squid Leopard seal Cod Small animals and protists Algae Krill In the food web above, there are eight food chains that include krill. In the space provided, identify all of the organisms in the order in which they occur in four of these eight food chains. 1. Chain 1
- Explain the effects on the ecosystem if Wood rat were removed. Provide both positive (if any) and negative impacts on the ecosystem. Be sure and include as many of the following terms in your writing as possible: autotroph, heterotroph, producer, primary consumer, secondary consumer, tertiary consumer, carnivore, omnivore, herbivore, energy, population, increase, and decrease.Consider a trophiccascade with 4 levels: 1) predatory fish that consume planktivorous fish, 2) planktivorous fish that consume zooplankton,3) herbivorous zoplankton that consume phytoplankton, and 4) phytoplankton. True or False: A reduction in predatory fish will increase the level of phytoplankton. True FalseWhen one species is better at obtaining and holding space than another, it is competitively dominant. Based on the diagram which non-mobile (sessile) species is the dominant competitor in the intertidal? Which is second? Rank the six non-mobile species from (1) most to (6) least competitively dominant. Below are the competitive arrows from the slides (recall that sessile consumers are superior competitors over the algal species). gooseneck barnacle mussel acorn barnacle coral weed black pine Primary Producers nori seaweed 1= strongest competitor and 6= weakest competitor common coral weed [ Choose ] nori seaweed [ Choose ] black pine algae [ Choose ] mussels [ Choose ] acorn barnacles [ Choose ] gooseneck barnacles [ Choose ] > > > >