Use the sequence from the pre-mRNA shown below to answer the following question. 5'-UCGGGCCAUUCAGGUGAGACGUAAU GCGCUUACCUAUACAGGACCG-3' What would be the sequence of the spliced mRNA? (Remove the intron.)
Q: What muscles contract in response to the activation of right PPRF? In what direction do the eyes…
A: Paramedian pontine reticular formation, also known as PPRF or para-abducens nucleus. Normal visual…
Q: To get approved by the FDA generic drugs have to demonstrate the following: That their bio…
A: Generic medications are copies of brand-name medications created by another company that is produced…
Q: Does the Solute inside or outside the cell?
A: Introduction When two solutions are next to one another and are divided by a semipermeable…
Q: Your female patient is 5'7" and is 20 years of age. Calculate her predicted vital capacity asap
A: The greatest amount of air that you can "transport into or out of our lungs in a single respiratory…
Q: In the presence of saturating amounts of oxaloacetate, the activity of citrate synthase from pig…
A: Introduction : The first four-carbon intermediate in the citrus acid cycle, succinyl-CoA, is…
Q: Explain the technologies and methods used for food production by modern society.
A: Since the inception of farming nothing much had changed before the Green Revolution. It was the…
Q: A beaker contains two compartments (A and B) with equal volumes of solution separated by an…
A: Since beaker A contains 3% albumin solution and beaker B contains 2% potato starch solution.…
Q: Describe how retinotopic information from the right and left visual fields are transmitted from the…
A: Retinotopic information from right and left visual fields are transmitted from the retinas to the…
Q: If a male cat with orange fur produces female offspring with calico fur, what color was the mother…
A: Let the genotypes of male and female cats be as follows- XBXB- black fur female XRXR- Orange fur…
Q: In nickel column affinity chromatography,how does the protein binds to column?How is the protein…
A: Column chromatography is a very common method of protein purification.Proteins may vary hugely in…
Q: Question 5. Evolution of Prokaryote into the Eukaryote cell type. A. What are the significant the…
A: With fossil evidence reaching back to over 3.5 billion years ago, prokaryotes are one of the oldest…
Q: Assume that birds with the genotype L L have blue feathers, and those who have at least one…
A: We can identify the correct answer as follows- A. 50% of the offspring will have blue feathers.…
Q: The figure below illustrates partial models of a starch molecule and a cellulose molecule, two…
A: Introduction The carbon compounds present in living organisms are collectively known as…
Q: 5. Set up the punnett square for each of the crosses listed below. The characteristic being studied…
A: The potential genotypes of an offspring resulting from a specific cross or breeding event are…
Q: (Purple) (White) 12. Two plants, both heterozygous for the gene that controls flower color are…
A: According to Mendel, the allelic pairs of the height-related genes, TT and tt, are identical in…
Q: All eukaryotic DNA is located in the nucleus. Determine whether the statement is True or False. And…
A: Eukaryotes have true nucleus. It means the nucleus is surrounded by nuclear membrane which contains…
Q: find one primary research article about nurse plants, and make a post that includes the following…
A: 1, Hypothesis: Regarding both species-specific (life strategy and dispersal) and environmental…
Q: 79.
A: The trait is the DNA sequence. It influences the morphology of the organisms. The number of traits…
Q: Which of the following is an objective for the following study: Male birds are usually more colorful…
A: Males are often more colourful than females in the animal world because of sexual selection. This…
Q: hypothalamus thyrotropin-releasing hormone (TRH) inhibition inhibition anterior pituitary…
A: Correct option is d A decrease in thyroxine level means a loss of inhibition to hypothalamus and…
Q: During the 20th Century, scientists in the USSR undertook a program to domesticate foxes. The…
A: Foxes who were most willing to interact with humans were considered the most tamed ones. They were…
Q: 10. In pea plants purple flowers are dominant to white flowers. If two white flowered plants are…
A: Since you have asked multiple questions, we will solve first question for you. If you want any…
Q: .is stachyose found in plant‘s seed or root?or leaf? 2.Does stachyose present in human‘s milk? 3.…
A: A tetrasaccharide called stachyose is made up of sucrose and an alpha-D-galactose moiety that is…
Q: Which of the following most directly applies to the formation of the secondary structures of…
A:
Q: Which of the following are found in eukaryotic cells but not in prokaryotic cells? A endoplasmic…
A: Prokaryotic cells are single-celled microorganisms that are thought to be the oldest on the planet.…
Q: 1. Which of the following are NOT hallmarks of cancer? a. Growth signal autonomy and angiogenesis b.…
A: Hallmarks of cancer is an integrative concept that helps to aid the cancer related complexity into…
Q: Which of the following statements are true regarding genetic variation in sexual reproduction…
A: Sexual reproduction is basically the production of new organisms by the fertilization of two gametes…
Q: enzymes are efficient catalysts because they can do which of the following? A) catalyze reactions…
A: The substrates are converted into products by means of enzyme. The enzyme enhances the rate of…
Q: 15. What is the relationship between molecular mass and mobility in the gel?
A: Disclaimer: - According to Bartleby guidelines, only the first questions can be answered unless…
Q: Which of the following best supports the theory that mitochondria are the product of an…
A: According to the endosymbiotic theory, the cell organelles such as mitochondria and plastids were…
Q: the
A:
Q: Z-scale descriptors are also calculated for artificial (synthetic) amino acids. Which of the…
A: Three descriptive scales—z1, z2, and z3—are employed for peptide QSAR. In this case, z1 refers to…
Q: What is the climate for modern society and how does climate change impact the environment, if at…
A: Environmental science is one of the sciences that we must learn that every living thing on this…
Q: LO 79 Explain that a phenotype might be monogenic at the molecular level, but polygenic at the…
A: The physical characteristics of an organism that can be observed, such as its appearance, growth,…
Q: a skeletal muscle cell has depleted its stores of ATP how will the altered transport properties of…
A: Skeletal muscle is one of the three significant muscle tissues in the human body. Each skeletal…
Q: Gaucher disease, caused by the inhibited digestion of lipids, results in the accumulation of fatty…
A: Gaucher disease is an inherited disorder caused by an enzyme deficiency. It is characterized by an…
Q: Cells that are undergoing the process of mitosis contain condensed chromosomes that are attached to…
A: The question is related to the cell division , in the cell division there are several steps where…
Q: Cardiac action potentials have _________ duration than neuronal action potentials. A. a shorter…
A: Introduction Unlike the action potential in skeletal muscle cells, the cardiac nerve impulse isn't…
Q: LO 66- Identify how molecular processes (replication, transcription, translation, gene expression,…
A: Properties of COVID-19 - Covid19 is caused by the coronavirus. coronavirus is a positive-stranded…
Q: 13. In guinea pigs, the allele for short hair is dominant over long hair. Two short haired guinea…
A: The type of variant present at a specific locus (i.e., region) in the genome is scored by what is…
Q: Which technologies below seem to be using CRISPR-Cas as a basis? Modification of RNA vaccines by…
A: Introduction:- CRISPR-Cas is one of the present day evolving technologies which is used in genome…
Q: LO74 Explain how epigenetic markers are inherited. How do epigenetic marks compare in monozygotic…
A: Introduction : Changes in the expression and operation of the genes are a part of the epigenetics…
Q: In the Lab field, what are attributes you feel are necessary for a successful career and why.
A: The occupation of a laboratory technician combines science and technology, To get success as a…
Q: How can the knowledge that we gained from the Zika and Ebola outbreaks be applied to this current…
A: There has been multiple pandemics in the last century. These pandemics has frequently been examined…
Q: The head of the oncology divison of a large biotech company proposes to develop a therapeutic…
A: For cancer treatment, there are several options. The treatment a patient receives depends on the…
Q: What are the 3 types of post-transcriptional modifications and what are they for?
A: Transcriptional modification is a set of biological processes in which an RNA transcript is…
Q: The DNA sequence below is transcribed from left to right (the partner/coding strand is shown). Using…
A: DNA is a double helical structure with two DNA strands. One strand serves as a template for the…
Q: DNA from a species with 40% G/C content will display a higher melting point than DNA from a species…
A: GC rich DNA has a highr meling point. This is because there is presence of triple bond between G and…
Give Detailed Solution (no need Handwritten)
Step by step
Solved in 2 steps
- For the messenger RNA sequence below, find the beginning of the amino acid coding sequence and translate the sequence using the genetic code provided below. 5' - AAUUAUGGGCAAUAUGCCGGGCcGGUUAAGCG - 3' Second Letter A UGU cys u UGC Phe UCU UU U UUC UUA UAU Tyr Ser UAC UAA UAG Leu UCA Stop UGA Stop UUG UCG Stop UGG Trp CUU CU CAU His CGU c cuc Leu ccc ССА CCG Pro CÁC CAA CAG CGC CGA CGG Arg CUA CUG Gin 1st 3rd letter Ser u letter AUU ACU AAU AAC AAA AAG Asn A AUC AUA AUG lle ACC ACA AGU AGC AGA AGG Thr Lys Arg Met ACG GUU G GUC GUA GUG GCU GAU GAC GAA Asp GGU Val GCC Ala GGC Gly GCA GGA Glu GCG GAG GGG GGiven the DNA sequence below: 5’-ACATGTGTACAGGCTTTGTCTGAATGGCTT-3’ 3’-TGTACACATGTCCGAAACAGACTTACCGAA-5’ Transcribe the gene. (Write the primary structure of the mRNA that will be produced.)Using the genetic code table provided below, identify the open reading frame in this mRNA sequence, and write out the encoded 9 amino acid long peptide sequence: 5'- CGACAUGCCUAAAAUCAUGCCAUGGAGGGGGUAACCUUUU C A G U UUU Phe UCU Ser UUC Phe UCC Ser UAC UCA Ser UAA UCG Ser UAG UUA Leu Leu G C CUU Leu CUC Leu CCC CUA Leu CUG Leu AUU lle AUC lle AUA lle AUG Met ACG ACU Thr ACC Thr ACA Thr Thr A UAU Tyr UGU Cys Tyr UGC Cys CCU Pro CAU His CGU Arg Pro CAC His Pro CAA Gln CGC Arg CGA Arg CCA CCG Pro CAG Gln CGG Arg GUU Val GCU Ala GAU GUC Val GCC Ala GAC GUA Val GCA Ala GAA GUG Val GCG Ala GAG Stop UGA Stop UGG AAU Asn AAC AAA AAG AGU Asn AGC G Lys Lys Asp Asp Glu Glu Stop A Trp Ser Ser AGA Arg AGG Arg GGU Gly GGC Gly UCAG GGA Gly GGG Gly с U C A G U C A G U C A G
- Assume the following portion of an mRNA. Find a start signal, and write the amino acid sequence that is coded for. 5'-GCCAUGUUUCCGAGUUAUCCCAAAGAUAAAAAAGAG 3'Indicate the amino acid sequence of the protein encoded by the following mRNA molecule. Use the genetic code table and assume that the very first “AUG” the ribosome encounters will serve as the start codon and specify methionine. 5’-AAUUCAUGCCCAAAUUUGGGGCACGAAGCUUCUUAGGCUAGUCCUAAAAAA-3’Using the provided coding strand below: 5-ATCAGATGGCCGGGCCAATAGAATAGCTGT-3 Provide the mRNAstrand for the coding strand above. Type your answer in the box below. Use two dash lines in between the 5 and your first base, and two dash line between your last base and before 3' (follow formatting above). What is your Start codon? What is your Stop codon? 5-AUGGCCGGGCCAAUAGAAUAG-3 AUGGCCGGGCCAAUAGAAUAG
- What will be the overall anti-codon sequence in tRNA for this mRNA? 5’-GUAGCCUUAUCUAGCGAUCACCGUCCGUAUUACUAGUGGCCAGACUCUUUUCACCAUGUAUAGUUG-3’What is the sequence of the mRNA transcript that will be produced from the following sequence of DNA? The top strand is the template strand, the bottom strand is the coding strand. 5’ – TCGGGATTAGACGCACGTTGGCATACCTCG – 3’ 3’ – AGCCCTAATCTGCGTGCAACCGTATGGAGC – 5’ Enter the mRNA sequence here (pay close attention to the direction of the molecule!): 5'-_____-3'The amino acids, in one-letter symbols and no spaces, coded by the following mRNA sequence is 5’ AAUGGAACGUCGGUACUGCCAUCGCAUUAGUACCAUGGCAAGCUGAAGC 3’
- Translate the following mRNA into protein, starting from the first initiation codon: 5'-CCGAUGCCAUGGCAGCUCGGUGUUAC AAGGCUUGCAUCAGUACCAGUUUGAAUCC-3'Give the single letter translation for the protein encoded by this mRNA. Start with the start codon. 5' M7GPPP- CCGACGUAUAUGGCGACUGAUCACUGACCAACGAAAA O ATDHXPTK OPTYMATDH MRAHVT O MATDH AAAAAA - 3'The sequence below shows the non-coding strand from the whole of the transcribed region of a very short gene. 5’-GGCTTCTTTAGTACTGGCCAGTGGGATCCAAGTAGGCTGCCATTTCGT-3’ Write out the sequence of the mRNA from this gene in the orientation 5′ → 3′ and, using the genetic code (see Fig. 1. overleaf) deduce the amino acid sequence of the peptide it encodes (NB you should read about the operation of the genetic code prior to attempting this question).