Using the mRNA codon table below and your knowledge of transcription and translation, complete this information: DNA Sequence: 5' ATG GAA 3' non-template strand DNA Sequence: 3' TAC ATA 5' mRNA sequence 5' 3' amino acid sequence: Met C
Q: Derive the amino acid sequence that is coded for by each of the following mRNA sequence. 5' CAA…
A: Amino acid are molecules which are combine to form a protein molecules.Amino acid are synthesized by…
Q: During the termination of translation, what is the correct polypeptide sequence which will be…
A: DNA is the storehouse of genetic information. This information age expect by the formation of an…
Q: All of the following mRNA codons signal the end of translation, in both prokaryotes and eukaryotes,…
A: The translation is a molecular process of synthesis of protein from genetic information encoded in…
Q: Examine the following coding strand DNA nucleotide sequence,representing the complete gene sequence…
A: Note: As per Bartleby Guidelines For Remaining Answers Please Repost The Question. Introduction: A…
Q: Use the bank of terms listed to label all important structures of the diagram of the translation…
A: According to the given translation complex diagram, the structures present are 131 - Polypeptide 132…
Q: Consider the following portion of mRNA produced by the normal order of DNA nucleotides: 5’ – CUU AAA…
A: Transcription is process through which DNA is converted into mRNA.
Q: Consider this list (below) of steps involved in translation. These steps are out of order.…
A: Translation is the process by which ribosomes in the cytoplasm or endoplasmic reticulum generate…
Q: Following is an mRNA sequence reported in data base. 5’ ACC AGA ATG ACC ATG GCA 3’ If there are…
A: Ribonucleic acid (RNA) also contains genetic material but rarely takes part in transferring the…
Q: The following is part of the non-template strand of DNA for a gene. 5'-TACTATCATGAGAGATAGGAG-3'…
A: Transcription is the process by which the information in a strand of DNA is copied into a messenger…
Q: Here is the sequence of a portion of a bacterial gene. The template strand is on the bottom: 5’-…
A: DNA and RNA are are nucleic acids present in the organisms. DNA is the deoxy ribose nucleic acid…
Q: Indicate which of the following items are associated with transcription or translation. This could…
A:
Q: elow is the 5’–3’ strand of a double-stranded DNA molecule with the following nucleotide sequences:…
A: DNA and RNA are the genetic material which have the genetic information about perticular organism…
Q: Directions: Transcribe the DNA sequence in the space provided. Use your notes and what you know.…
A: Transcription A process of making of mRNA from DNA. mRNA contain information about polypeptide…
Q: Without using your textbook, determine what protein sequence would be translated from the mRNA…
A: DNA is the store house of genetic information. This information is in the form of nucleotide…
Q: Shown below is the sequence of the 5' end of a hypothetical mRNA. Where does translation of this…
A: Translation occurs when the mRNA gets attached to the ribosome and subunits and the initiation…
Q: Which of the following are steps of transcription? Select all that apply. a.RNA polymerase…
A: The function of a gene can be studied through expression in a particular cell and its interactions…
Q: Which of the following mRNA sequences codes for the polypeptide sequence tyrosine-leucine-alanine?…
A: Transcription is the process that synthesizes mRNA from DNA. The mRNA strand synthesized through…
Q: Which of the following is not involved in the elongation of prokaryotic peptide? a. EE-Tus, EE-Ts,…
A: The translation is the process by which protein is synthesized with the help of mRNA, tRNA, and…
Q: On the mRNA codon table below, the first nucleotide in mRNA is to the left, the second is above, and…
A: The DNA is transcribed into mRNA by the process of transcription and this mRNA is translated into…
Q: Sequence the following steps in protein synthesis from first to last (1-6) ___A. Transciptions…
A: TRANSLATION is the process by which a protein is synthesized from the information contained in a…
Q: For the following characteristics, state whether they are true for the 5' CAP, the Poly-A tail, BOTH…
A: Central dogma is the mechanism by which information of DNA is converted into a product (protein ) by…
Q: Which of the following best describes the initiation of translation? A. The mRNA binds the large…
A:
Q: Complete the table below: DNA DNA Complimentary Strand mRNA sequence tRNA sequence Amino…
A: Deoxyribonucleic acid is a molecule composed of two polynucleotide chains that coil around each…
Q: Which of the following statements about the translation process is correct? a. RNA is made…
A: Gene expression is the process by which a gene is turned on in a cell to make RNA and proteins. It…
Q: Below is a diagram of charged tRNAs in the active site of the ribosome during translation of the…
A: Translation is the process of synthesis of protein. It takes place in the cytoplasm.
Q: if the following DNA sequence were transcribed, which of the following describes the output of this…
A: DNA is the genetic material in most living organisms. It is the information hub of the cell that…
Q: Transcribe the following DNA molecule into mRNA. Make sure to find the start codon to begin your…
A: A start codon initiates the transcription while stop codon terminates the transcription process.
Q: Below is the sequence of an mRNA that has just been transcribed. Please translate this sequence as…
A: Let's rearrange the mRNA in the codes of three. ACG UCC AAU GGC AGU GAU UUG AAU CCA ACG codes for…
Q: In picture a (look at picture) a tRNA is already bound to the initiator codon at the start of the…
A: Translation is the process of synthesis of polypeptides (protein) by combining monomers units…
Q: Which of the following are stages of translation?
A: The translation is the process of converting the information in mRNA to Proteins. Ribosome which has…
Q: An mRNA transcript is listed below and contains both start and termination codons. Assume that the…
A: mRNA(messenger RNA) is a type of RNA(ribonucleic acid) that carries complementary sequence…
Q: Which of the following is the definition of a gene? A. RNA that delivers amino acids to a ribosome…
A: Genetics is a science of the study of genes. It involves the identification of specific genes for…
Q: A section of an mRNA has the following nucleotide sequence: GCA GCU UGC CAG For the mRNA sequence…
A: In the question, we are given with mRNA sequence. mRNA is a sequence of ribonucleotides synthesized…
Q: Part A) In your own words describe what happens in transcription and translation Include which…
A: DNA(Deoxyribonucleic acid) is defined as type of double helical molecule composed of two…
Q: Which of the following interactions in E. coli ensures that the start codon of an mRNA is accurately…
A: The translation is the process of producing protein mRNA as a template and peptidyl activity of the…
Q: Below is a double-stranded DNA: ATATGTGGTCTCGGTCCGTTAGGCAAT TATACACCAGAGCCAGGCAATCCGTTA Which…
A: According to the central dogma of life, DNA replicates to form copies of itself. DNA acts as a…
Q: Which of the following anticodons of a tRNA molecule can base pair with three different codons on an…
A: DNA is the genetic material in most living organisms. It is the information hub of the cell that…
Q: Here is an mRNA sequence (written 5' → 3') A G G G A G G U A A C A G 14 15 16 17 18 19 20 21 24 27…
A: The translation initiation codon is the 5'-AUG-3'. From this codon the first amino acid is…
Q: Use your codon chart to determine the amino acid sequence. Remember to read through the strand and…
A: Transcription is the process of copying information present in the DNA to RNA. The information…
Q: In this picture, a tRNA is already bound to the initiator codon at the start of the mRNA strand. The…
A: The central dogma states that the genetic information will flow from DNA to RNA and then to protein,…
Q: A mRNA has the following sequence and direction: 5’-AUGUCAACCUAA-3’ What would be the anticodon…
A: Messenger RNA (mRNA) carries the genetic information copied from DNA in the form of a series of…
Q: A small section of bacterial mRNA has the following nucleotide sequence: GAC CCG AUG AAC The tRNA…
A: Translation It is the synthesis of proteins from the codons present in the mRNA. Anticodons…
Q: A particular triplet of bases in the template strand of DNA is 5' AGT 3'. The corresponding codon…
A: ANSWER;- 3'UCA 5' Explain;- Transcription is a process of a particular DNA sequence being copied…
Q: In panel a (see picture), a tRNA is already bound to the initiator codon at the start of the mRNA…
A: The central dogma states that the genetic information will flow from DNA to RNA and then to protein,…
Q: A scientist sequencing mRNA identifies the following strand: CUAUGUGUCGUAACAGCCGAUGACCCG What is the…
A: Amino acids are the organic compounds that contain the amino group (–NH2) and carboxyl group(–COOH)…
Q: Which of the following are involved in transcription? Select all that apply a. rRNA b. DNA c.…
A: Transcription allows the formation of an intermediate between the DNA and the proteins which are the…
Q: codon
A: The number of codon binding sites in an mRNA-ribosome complex that can be occupied at the same time…
Q: A particular triplet of bases in the anticodon strand of the tRNA is 5' - AGU - 3'. A. The…
A: The single-stranded RNA is called messenger RNA. The ribosomes read an mRNA when making proteins.…
Q: the coding strand of DNA has the same sequence as the mRNA, except that there are U’s in the mRNA…
A: an delete the 'C' at position 52 Explanation: it is the type of frameshift deletion mutation…
Q: Which of the following mRNA codons signals the start of translation in eukaryotic cells? 5’-UGA-3’…
A: There are 3 stop codons: UAG(Amber) UAA(ochre) UGA(umber) These codons signal the termination of…
Using the mRNA codon table below and your knowledge of transcription and translation, complete this information:
DNA Sequence: |
5' |
ATG |
GAA |
3' |
non-template strand |
|
DNA Sequence: |
3' |
TAC |
ATA |
5' |
|
|
mRNA sequence |
5' |
3' |
|
|||
amino acid sequence: |
Met |
C |
|
![](/static/compass_v2/shared-icons/check-mark.png)
Trending now
This is a popular solution!
Step by step
Solved in 2 steps
![Blurred answer](/static/compass_v2/solution-images/blurred-answer.jpg)
- Given the following mRNA, write the double-stranded DNA segment that served as the template. Indicate both the 5 and the 3 ends of both DNA strands. Also write out the tRNA anticodons and the amino acid sequence of the protein encoded by the mRNA message. DNA: mRNA: 5-CCGCAUGUUCAGUGGGCGUAAACACUGA-3 protein: tRNA:The following segment of DNA codes a protein. The uppercase letters represent Exons, the lowercase letters introns. Draw the pre- mRNA, the mature mRNA and translate the codons using the genetic code to form the protein. Identify the 5’UTR and 3UTR 5’- AGGAAATGAAATGCCAgaattgccggatgacGGTCAGCaatcgaGCACATTTGTGATTTACCGT-3’If DNA segments changes from GCATAG to GCATA, this is a: MRNA Codon/Amino Acid Chart First Base Second Base Third Base U A G 0001 Phenylalanine UCU UAU1 Tyrosine (Tyr) UAC UGUT FCcysteine (Cys) UGCJ U UUCJ (Phe) UCC Serine (Ser) UCA U UUA1 UAAT UGA - Stop A FLeucine (Leu) UUG- FStop UAG- UCG- UGG - Tryptophan (Trp) G CU- CCU CGUT CAU1 Histidine (His) CAC U CUC FLeucine (Leu) CUA CC Proline (Pro) CCA CGC FArginine (Arg) CGA CAA1 Glutamine A CAGI (Glu) CGG- CUG- CCG- G AUU AAU1 Asparagine ACU1 AGUT FSerine (Ser) AGC- AUC FIsoleucine (le) ACC Threonir AACJ (Asn) A AUA- ACA (Thr) AAA1 FLysine (Lys) AAG- AGA, FArginine (Arg) AGG- A Start Methionine (Met) ACG- AUG - GUU- GCU GAU- GGU | Aspartic Acid GAÇJ(Asp) U GỤC Valine (Val) GUA GCC FAlanine (Ala) GGC Glycine (Gly) GGA G GAA1 Glutamic Acid A GCA GCG- GAGJ (Glu) GGG- GUG- G
- For each of the following items, fill in either the DNA strand, the MRNA codons, the tRNA anticodons, or the amino acid sequence that have been left blank. If several sequences might work, choose only one. Furthermore, circle the start and the stop codons of each mRNA sequence. 1. DNA (3'-5') ACG TAC GGC CGG TTA AAG CAT ACT TTC TTG MRNA TRNA Amino Acid 2. DNA (3'-5') MRNA AUG ACU AGC UGG GGG UAU UAC UUU UAG AAA TRNA Amino Acid 3. DNA (3'-5') MRNA TRNA GCU CCU UAC CAC ССС CGU AUG GCU GGG AUC Activate Go to Sett Amino AcidUse a codon chart determine the amino acid sequence. Remember to read through the strand and ONLY start after the promoter and STOP when it tells you to stop. Follow example below: Example: DNA AGA TATA TAC CTC CGG TGG GTG CTT GTC TGT ATC CTT CTC AGT ATC MRNA O protein AUG GAG GCC ACC CAC GAA CAG ACA UAG GAA GAG UCA UAG start-glu-ala-thre-hist - asp-glu-threo-stop met DNA CCT ATA TAC ACA CGG AGG GTA CGC TAT TCT ATG ATT ACA CGG TTG CGA TCC ATA ATC mRNA DGGA UAU) AUG uGul Gcc nccl cAul GCol protein ly Tur MeT cys AlA ser HIJ Ala 2 3 4 DNA AGA ACT ATA TAC CTC TTA ACA CTC TAA AGA CCA GCA CTC CGA TGA ACT GGA GCA mRNA protein DNA TAT ATAC CTT GGG GAA TAT ACA CGC TGG CTT CGA TGA ATC CGT ACG GTA CTC GCC ATC mRNA protein D DNA TAA ACT ATA TAC CTA GCT TAG ATC TAA TTA CCC ATC mRNA protein Auu UGA UAU AGU GAUCGA AUC MAG Auu AAU leu Stop. TRY-Met-Asp- ARG-Isle-Stop-Ile. Asn DNA CTA TTT ATA TAC TAG AGC GAA TAG AAA CTT ATC ATC mRNA protein D DNA CAT ATA TAC CTT AGT TAT CCA TTG ACT CGA ATT GTG CGC TTG…If DNA segments changes from GCATAG to GCATGG, this is a: MRNA Codon/Amino Acid Chart First Base Second Base Third Base A G UUU1 Phenylalanine UCUT UAUT FTyrosine (Tyr) UAC UGU, U FCysteine (Cys) UGCJ UUCJ (Phe) UCC Serine (Ser) UCA U UGA - Stop A UUA1 FLeucine (Leu) UUG- UAA1 FStop UAGJ UCG- UGG - Tryptophan (Trp) G CUU CAU1 CCU1 CGUT Histidine (His) CAC- CUC CCC Proline (Pro) CCA CGC FLeucine (Leu) CUA FArginine (Arg) CGA CAA1 Glutamine A CAGJ (Glu) CGG- CUG- CCG- ACU AAUJ Asparagine AUUT AGUT FSerine (Ser) AGC- U AUC FIsoleucine (lle) ACC AACJ(Asn) Threonine A AUA- (Thr) AAA1 FLysine (Lys) AAG- АСА AGA, FArginine (Arg) AGG- A Start Methionine AUG- (Met) ACG- G GUU GCU, GAU1 Aspartic Acid GGU U GAÇJ(Asp) GUC Fvaline (Val) GUA GCC GGC G Alanine (Ala) GCA Glycine (Gly) A GAAJ Glutamic Acid GGA GAG- (Glu) GUG- GCG- GGG- G
- Write the sequence of the mRNA molecule synthesized from a DNA template strand having the sequence 5'-ATTACAGGCGGT-3' 5'- UAAUGUCCGCCA Incorrect Write the amino acid sequence encoded by the mRNA base sequence 5'-GAGUUAGUUUGUAAGUGC-3' Assume the reading frame starts at the 5' end. Refer to the codon table . Amino acid sequence: Glu-Leu-Val-Cys-Lys-Cys What is the sequence of the polypeptide formed on addition of poly(UUAC) to a cell-free protein-synthesizing system that does not require a start codon? Enter an amino acid sequence of four amino acids using the three-letter abbreviations. Polypeptide sequence: Poly( -3' Glu-Leu-Val-Cys-Lys-CysThe DNA sequence below is transcribed from left to right (the partner/coding strand is shown). Using this sequence, write the sequence of the polypeptide that results from this gene. Be sure to appropriately label the ends of the molecule. 5'-ATGCACGGCGACTAG-3' Second letter A UAU Tyr UAC First letter U A G U UUU1 UUC UUA LOU Leu CUU CUC CUA CUG Phe GUU GUC GUA GUG Leu AUU AUC lle AUA AUG Met Val C UCU UCC UCA UCG CCU CCC CCA CCG ACU ACC ACA ACG GCU GCC GCA GCG Ser Pro Thr Ala CAU His CAC CAA CAG Gin AAU Asn AAC AAA 1 Lys AAG LYS G {}a UAA Stop UGA Stop A UAG Stop UGG Trp GAU 1 GAC Asp GAA GIU Glu GAGJ UGU UGC CGU CGC CGA CGG AGU AGC AGA AGG Cys GGU GGC GGA GGG Arg Ser Arg DOA DOA DOA DUTO Third letter GlyThe sequence below is a template strand sequence for a gene (a very short one!). Identify the start codon and the amino acid sequence of this gene. Write your answer in 3 letter amino acid code. Put a hyphen between each amino acid. You should also include a description of any working or steps you have taken to determine your answer. 5' AGTCAGCAAGAAGACATCAGTGTTCCCATCTGT 3' Paragraph V B I U A = 8⁰ + v 11.
- 1) Complete the following tables by filling in the DNA sequence, MRNA codons, and the amino acids expected in the final protein (using the MRNA codonstable): DNA TAC CGC TCC GCC GTC GAC AAT ACC ACT MRNA Amino Acid DNA TGA C АTG ATC MRNA AUG ACU AGC UGG GGG UAU UAC U00 UAG Amino Met Ser Trp Tyr Phe Acid DNA TAC CAC CGT ATG GCT GGG AAT ATC MRNA Amino AcidAnswer the following whether it is TRUE or FALSE: 1. For each DNA segment 3'-ACCTGCCTACCCG-5' the sequence of the mRNA molecule synthesized is 5'-TGGACGGATGGGC-3' 2. In the template strand TACCGAGGTATGTAC, the coding strand is 5'-ATGGCTCCATACATG-3'. 3. In the template strand TACCGAGGTATGTAC, the coding strand is 5'-AUGGCUCCAUACAUG-3'. 4. The template strand is the strand of DNA used for RNA synthesis. 5. Transcription forms a messenger RNA molecule with a sequence that is identical to the DNA template from which it is prepared.The DNA in the coding strand below contains a short imaginary sequence for a short protein in Squibillus notables (imaginary bacterial organism). Indicate the mRNA and amino acid sequences. Label the 5' and 3' ends, the amino (N-terminus) and carboxyl (C-terminus) ends and start/stop codons, if present, as appropriate. 5'- ATGTACCTCGACGATCAAGGCAA -3'
![Human Heredity: Principles and Issues (MindTap Co…](https://www.bartleby.com/isbn_cover_images/9781305251052/9781305251052_smallCoverImage.gif)
![Human Biology (MindTap Course List)](https://www.bartleby.com/isbn_cover_images/9781305112100/9781305112100_smallCoverImage.gif)
![Biology (MindTap Course List)](https://www.bartleby.com/isbn_cover_images/9781337392938/9781337392938_smallCoverImage.gif)
![Biology Today and Tomorrow without Physiology (Mi…](https://www.bartleby.com/isbn_cover_images/9781305117396/9781305117396_smallCoverImage.gif)
![Human Heredity: Principles and Issues (MindTap Co…](https://www.bartleby.com/isbn_cover_images/9781305251052/9781305251052_smallCoverImage.gif)
![Human Biology (MindTap Course List)](https://www.bartleby.com/isbn_cover_images/9781305112100/9781305112100_smallCoverImage.gif)
![Biology (MindTap Course List)](https://www.bartleby.com/isbn_cover_images/9781337392938/9781337392938_smallCoverImage.gif)
![Biology Today and Tomorrow without Physiology (Mi…](https://www.bartleby.com/isbn_cover_images/9781305117396/9781305117396_smallCoverImage.gif)