What is the isoelectric point of the peptide LIKES? Show your work below.
Q: Using an arrow, draw the site of cleavage for the following peptides that are reacted by: Pepsin…
A: Amino acids are building blocks of peptides and polypeptide chain. Peptides are consist of 2-50…
Q: H₂C-O-C-(CH₂) 16CH3 i HC-0- H₂C-O-C-(CH₂) 14CH3 (a) -(CH₂)7CH=CH(CH₂)7CH3 H₂C-O-C-(CH₂) 14CH3 요…
A: Fats and oils are triglycerides or triacylcylgerols. They are esters which three fatty acid are…
Q: What effect is seen on a Lineweaver-Burke graph when a competitive inhibitor is added to an…
A: Competitive inhibition is an enzyme inhibition process where an inhibitor molecule (similar to the…
Q: Complete the reaction above by drawing the structure of PEP. Draw the molecule by placing atoms on…
A: Enolase is an enzyme that reversibly catalyze the dehydration of 2-phosphoglycerate to…
Q: Which of the following substances can deliver electrons to the ETC to help pump out H+ across the…
A: Electron transport chain is a chain of electron carriers that transfer electrons to molecular…
Q: Name the three major types of membrane lipids in animal cells and provide a specific example of…
A: The cell membrane is composed of lipids and proteins. A small amount of carbohydrates is also…
Q: 1. Inulin is a polysaccharide composed of entirely fructose units. Which test should be used to best…
A: Introduction : Inulin - Inulin is a type of naturally occuring polysaccharide which is produced by…
Q: The activity of an enzyme can be regulated by a: A) competitive inhibitor binding to the active…
A: The enzymes increase the rate of biochemical reactions and can be regulated by binding to…
Q: Question 23 of 25 Among the given statements, which ones describe the lysosomes? Select the correct…
A:
Q: What is the function of the alcohol in the extraction of DNA? What is the property/characteristics…
A: DNA extraction involves different steps which include, the breaking of cells to open and…
Q: ● What are the three things we need to know in order to begin to understand the way an active site…
A: Enzymes are high molecular weight proteins that catalyse biochemical reactions. The substrate binds…
Q: 1. State if true or false a. Gluconeogenesis is the exact opposite of the glycolytic pathway b.…
A: Note: Hi! Thank you for the question. We are authorized to answer three subparts at a time. Since…
Q: 1. Under what circumstances in the cell would the entire pentose phosphate pathway be carried out…
A: In animal tissues, glucose has two possible fates: be oxidised into carbon dioxide and water by…
Q: What is one technique or property of a protein that you could use to monitor the fractions so you…
A: In column chromatography, there is a stationary phase and the mobile phase. The stationary phase…
Q: Why are single strand binding proteins (ssb proteins) needed in DNA replication? (note that you need…
A: DNA consists of two strands of polynucleotide that are linked to each other via hydrogen bonding…
Q: In the free energy diagram below, molecule A (with energy x) is converted to molecule B (with energy…
A: Activation energy for a reaction is the minimum amount of extra energy that is necessary for the…
Q: Name three metabolic processes in the cell that are enhanced and two that are inhibited in response…
A: Insulin is a peptide hormone released by the beta cells of the pancreas. The key function of insulin…
Q: Why can plant material be substituted? Plants contain high amounts of saturated fats. Certain plants…
A: Introduction : Linoleate - A linoleate is a salt or ester of linoleic acid(which is an organic…
Q: 1. DNA: ATACGAAATCGCGATCGCGGCGATTCGG mRNA: Codon: Anticodon: Amino Acids: 2. DNA:…
A: During the process of transcription, one strand of the DNA act as the template for the synthesis of…
Q: What is DNA? Provide a 5-sentence long description only.
A: Nucleic acids, large macromolecules are necessary for all organisms and viruses to function. The…
Q: Given that the reduction potential Eo'= -320, +10, +816, and +50mV for NAD+, fumarate, O₂ and…
A: An oxidizing species is the substance that donates electrons, and a reducing species is the…
Q: INFLUENCE OF FREE ACID tt #1 tt #2 tt #3 tt #4 CONDITION 4 mL 0.2% HCI + 1 mL starch paste + 1 drop…
A: Effect of saliva on starch: Saliva contains the digesting enzyme amylase, which breaks down starch.…
Q: 9.) How many grams of H₂0 must be used to dissolve loog of sucrose (C₁2H₂2011) to prepare a 0.020…
A: Mole fraction is the ratio of moles of one component in a mixture to the total no of moles of all…
Q: Among the given statements, which ones correctly describe the commonality in dopamine and…
A: The adrenal gland secretes three catecholamines-dopamine, epinephrine and norepinephrine. Dopamine…
Q: Why is a protein's structure important? What can happen if there are any changes? Provide an example…
A: As per the central dogma of molecular biology, DNA contains the code that is necessary for the…
Q: Explain the cell response to FED, and then FASTED states, by glucose transporter (GLUT)-4. (answer…
A: Carbohydrate from food is converted to glucose by digestive enzymes which then enters the…
Q: Given 2 M Tris, pH 7.1 (pKa 8.0), 5 M NaOH, 5 M HCI, and water; how would you prepare 2 L of 0.2 M…
A: Equation of dilution: M1V1 = M2V2 where: M1 is the molar concentration of the stock solution. M2 is…
Q: 1. Write a short note on transcription. What is TFBS? What is the role of RNA polymerase?
A: Since you have asked multiple questions with multiple subparts, we will solve the first question for…
Q: b) It's said that secondary structures form because of intra- and intermolecular hydrogen bonding…
A: A protein's function depends on its structure. There are four levels of protein structure: primary,…
Q: 13. How would ATP production in an aerobic yeast culture change if we add the following metabolites…
A: Aerobic yeast culture is a metabolic process in which glucose is metabolize by fermentation even in…
Q: Question 9 Which of the following fatty acid does have greater solubility in wat O 16:0 O 18:0 O…
A: Fatty acids are a class of lipids that are nonpolar and are insoluble in water. The naturally…
Q: Consider the given data for an enzyme-catalyzed reaction. Determine the Vm, Km and the type of…
A: Parameters such as Km and Vmax are used for comparing enzyme activities. If we know the initial rate…
Q: Question 21 of 25 What are Gram-negative bacteria? Select the correct response(s): They have a cell…
A:
Q: Briefly explain the Warburg Effect. How can the Warburg effect be taken advantage
A: INTRODUCTION : Glycolysis : It is a metabolic pathway of the cells of body,in which Glucose is…
Q: 1a. Whats the difference between continuous and discontinuous synthesis? 1b. Why replication…
A: According to the semiconservative model of DNA replication proposed by Meselson and Stahl, each…
Q: 4. A single base addition and a single base deletion approximately 15 bases apart in the mRNA…
A: As per the central dogma of molecular biology, the genetic information stored in the DNA is copied…
Q: Canonical forces in protein folding. Describe how these forces come into play when a protein folds.
A: INTRODUCTION : Canonical forces in protein folding - Canonical forces are those forces which…
Q: PEP and 2-PG have similar amounts of potential metabolic energy with respect to decomposition to Pi,…
A: Glycolysis occurs in the cytoplasm of the cell. Glycolysis converts glucose into two molecules of…
Q: Will weighs 80 kg and his plasma osmolarity is 280 mOsm/L. He eats a salty snack containing 250 mM…
A: Plasma Osmolarity: The number of solute particles per 1 L of solvent is referred to as osmolarity.…
Q: More energy comes out of glucose degradation if pyruvate proceeds to the mitochondria for oxidative…
A: Degradation of glucose is termed as glycolysis which is a catabolic pathway in which 6 carbon…
Q: The net yield of ATP for the complete oxidation of one molecule of glucose is O 10 ATP O 24 ATP O 30…
A:
Q: Propose a pathway for the following compound to enter gluconeogenesis / glycolysis. In your pathway,…
A: Glycolysis is a collection of 10 enzymatically catalysed reactions that sequentially oxidise a…
Q: What effect does a negative effector have on the graph of reac- tion rate (V) vs. [substrate] for an…
A: INTRODUCTION : Allosteric enzymes : Allosteric enzymes are those enzymes which have an additional…
Q: 3. (a) The beakers below represent different conditions for measuring the initial velocity (vo) of…
A: Parameters such as Km and Vmax are used for comparing enzyme activities. If we know the initial rate…
Q: Among the given statements, which are characteristics of plant cells? Select the correct…
A: Plant cell has Cell wall as the outermost layer. Cell wall being the outermost layer surrounds the…
Q: Although initiation requires the sigma factor or sigma subunit be associated with the core RNA…
A: Transcription is a process by which RNA is synthesized using DNA as template. Transcription occurs…
Q: Given the following reaction below, what amino acid is involved and what is the specific reaction…
A: Phenylalanine, tyrosine, and tryptophan are aromatic amino acids. The side chain of the…
Q: What is the difference between starch and cellulose that makes one digestible and the other not…
A: Chemically carbohydrates are polyhydroxy aldehydes or ketones. They have the general formula :…
Q: How many moles of ATP can be gained from the catabolism of the following substrates to pyruvate:…
A: Glycolysis is a process of breakdown of glucose to 2 molecules of pyruvate. This process also forms…
Q: ) How many moles of ATP can be gained from the catabolism of the following substrates to pyruvate?…
A: Since you have asked multiple questions with multiple subparts, we will solve the first question for…
What is the isoelectric point of the peptide LIKES? Show your work below.
Step by step
Solved in 2 steps
- 11 111 FLATRON WIS songs to listen to on a late n (1) Messenger f 253282375 390061782796379 8 x ++ Scontent.fmnl17-4.fna.fbcdn.net/v/t1.15752-9/253282375 390061782796379 8678836692018933574_n.jpg?_nc_cat3D105&ccb%3D1-5&_nc_sid=Dae9488&_nc_eui2=DAeERUdQ E Apps Discussion Questions (answer these questions on a separate sheet of paper) 1. Explain how hCG secretion is regulated. Is it secreted by a pregnant woman or her offspring? 2. hCG depresses some reactions of the immune system. What adaptive advantage do you think this has? Ac P Type here to search LGIn your own words what is Matthew effect.Please help me with part one questions 3,4,5 Thank you PDF link https://www.cusd80.com/cms/lib/AZ01001175/Centricity/Domain/8922/eofad.pdf
- It is not an easy matter to assign particular func-tions to specific components of the basal lamina, sincethe overall structure is a complicated composite materialwith both mechanical and signaling properties. Nidogen,for example, cross-links two central components of thebasal lamina by binding to the laminin γ-1 chain and totype IV collagen. Given such a key role, it was surprisingthat mice with a homozygous knockout of the gene fornidogen-1 were entirely healthy, with no abnormal phe-notype. Similarly, mice homozygous for a knockout of thegene for nidogen-2 also appeared completely normal. Bycontrast, mice that were homozygous for a defined muta-tion in the gene for laminin γ-1, which eliminated just thebinding site for nidogen, died at birth with severe defectsin lung and kidney formation. The mutant portion of thelaminin γ-1 chain is thought to have no other functionthan to bind nidogen, and does not affect laminin struc-ture or its ability to assemble into the basal lamina.…What are e-cigarettes? Why do you the CDC and other public health official’s are worried about kids and teens using e-cigarette products? What regulations have the FDA put on e-cigs? What do you think can be done to prevent kids from becoming addicted to nicotine? In light of the severe effects of COVID-19 on the lungs, do you think more people will quit? In light of the severe effects of COVID-19 on the lungs, especially for people with pre-existing conditions, do you think more people will quit?A web.lrnr.us/courses/6241c4b1-ef4f-41db-8549-34b0c315b9f4/assignments/da0b072b-ad10-40b1-a0cb-ecc2d2baf7f5/activities/c04d4b52-bb67- irrnr laquajajones Courses > Human AP I Laboratory > Assignments > 01 Microscope Lmr HW > Peering Into the Invisible World C9 Peering Into the Invisible World FIB with muitiple drop down entries 0. My Fill in the blanks, using the choices provided, to correctly identify the contributions to the Cell Theory. G2 In the late 1600s, a Dutch tailor who crafted lenses, used his primitive microscope to view pond water, the plaque In 1665, from his own oral cavity, as well as his own sperm. He referred to all of the organisms he viewed as coined the term to describe the cork tissue he was observing through a lens. You sign 91°F P Type here to search
- A web.lrnr.us/courses/6241c4b1-ef4f-41db-8549-34b0c315b9f4/assignments/da0b072b-ad10-40b1-a0cb-ecc2d2baf7f5/activities/c04d4b52-bb67- irrnr laquajajones Courses > Human AP I Laboratory > Assignments > 01 Microscope Lnr HW > Peering Into the Invisible World C) Peering Into the Invisible World FIB with muitiple drop down entries 0. My Fill in the blanks, using the choices provided, to correctly identify the contributions to the Cell Theory. G2 In the late 1600s, a Dutch tailor who crafted lenses, used his primitive microscope to view pond water, the plaque In 1665, from his own oral cavity, as well as his own sperm. He referred to all of the organisms he viewed as coined the term to describe the cork tissue he was observing through a lens. You sign 91°F P Type here to searchPlease help me with part one question 4 Thank you PDF link https://www.cusd80.com/cms/lib/AZ01001175/Centricity/Domain/8922/eofad.pdfPA Tupnu u ow nh8 The jaom od Figure 38-10 Biology; Life on Earth, 8/e © 2008 Pearson Prentice Hall, Inc. a) On the diagram above, label the motor neuron, the sensory neuron, the interneuron, and the effector. b) List any way or ways in which the nervous system will determine the intensity of the pain in the example above. 12) 12 TO
- MAP= CO x TPR / 80 I don't understand the value of TPR how do I get this number?TO BV.0 29.0 bnuod lo POS bazasiet al O Which effector has less affinity for the fetal Hb subunity?r of a. 2,3-BPG V b. 02 c. H+ d. Co ([2]+)\([2] x6m V) = V (b + [J]) \ [J] = 0 (r369 2tnioq S) anoitu soir siqitium.IO Enzymes are chemical catalysts because they it ai gniwollot 9d to doir W a. Alter the equilibrium concentration of productser ni noni erT .6 b. Lower the energy of activation of the reaction i midolgov d c. Are consumed in the reactionidolgomeni bas nidolgoym tod d. Alter the equilibrium concentration of reactants nidolgom9H.b Which of the following actions of enzymes affects the overall entropy W change of a reaction? 9med b16wot 29vom 9nibiteid lemixo1q edT 6 a. Stabilization of the transition statened to noni art of abnid s0.d b. Provide alternative path for product formationom xiler 79T c. Orientation of substrates for reactions to occurni 29vom now.b d. Lower the activation barrier Jonsgil son6 4 91010 6 99wted gnibnid 99 10 Which metabolite transformation reactions…what does TPN means? and where do you use it for?
