Q: Referring to the figure below, explain why NADH yields more ATP than FADH2 does. Electron-transport ...
A: The electron transport chain is a combination of four protein complexes that connect redox processes...
Q: Name 2 indirect methods for measuring microbial growth and describe how each is performed. a. i. A...
A: Two indirect methods for measuring microbial growth are : 1. Turbidimetric method 2. Standard plate...
Q: Describe how you would predict the amount of mRNA for gene A and gene B in two normal cells if you o...
A: Central dogma is the molecular process by which DNA is transcribed into mRNA, mRNAs then translated ...
Q: Which of the following scientific names shows correct usage of binomial nomenclature? Group of answe...
A: Introduction Binomial nomenclature:- It is the biological system that is used to name an organism, I...
Q: Which of the following is a physiological or functional variation? Inability to absorb glucose color...
A: Physiological variation refers to the variances in how members of the same species respond to enviro...
Q: What is the phenotypic ratio produced by the cross at after birth? a. 3:0 b.3:1 c. 1:2:1 d.all alik...
A: Short spine is caused by a new lethal gene in homozygous condition that leads to shortness of the sp...
Q: Which of these characteristics is NOT shared by bacteria and archaea? O presence of plasma membrane ...
A: Sol: Bacteria and archaea are the prokaryotic microorganisms. They are prokaryotes because they lack...
Q: No two people are genetically identical, except for identical twins. What is the main source of gene...
A: Answer: new mutations that occurred in the preceding generation
Q: Diagram showing the evolution of a domesticated crop
A: Domestication of crops is a strategy that involves the process of artificial selection of plants in ...
Q: What best describes the hind leg bones seen in the whale? Leg bone O Analogous structures to the fin...
A: INTRODUCTION Vestigial structure The anatomical structures which has no longer purpose in the curren...
Q: The pericardial cavity is a part of which cavity? pelvic cavity abdominal cavity pleural cavity tho...
A: 4. Thoracic cavity
Q: Keystone Species Microbiome Diversity Plant Diversity
A: The foundation(establishment) (1) or misfortune (loss) (2) of a cornerstone animal varieties (number...
Q: Picture yourself sitting at the dinner table with your family. You start comparing everyone's toes (...
A: The genes that can mask the expression of other alleles are called dominant and are denoted by upper...
Q: Give the NADH, ATP and FADH production from each part of photosynthesis, and what is their role
A: Carbon dioxide is emitted while ATP, NADH, and FADH2 are produced.
Q: Non-enveloped viruses are released by O a. Inducing cell lysis O b.Assembling in the nucleus Oc. Env...
A: Introduction Viruses:- It is a microscopic parasite, generally much smaller than bacteria and simple...
Q: Raedwald is color blind. His four sisters and his parents all have normal color vision. Who passed...
A: Introduction:- The X chromosome contains the gene that causes colour blindness. Red-green colour bli...
Q: What is Lamarck's Theory of Acquired Characteristics? Please give a brief explanation, thanks.
A: An acquired feature is something that has formed in the somatic or body cells of an individual over ...
Q: D E -E ET
A: Rats share many common similarities with humans and they both are mammals. This is the reason most o...
Q: In corn, kernel color is governed by a dominant allele for white color (A) and by a recessive allele...
A: Answer--option c- 0.23
Q: A eukaryotic gene is added to a mixture containing a restriction enzyme EcoRI and a bacterial plasmi...
A: Which media allow growth of bacteria that did not take up any plasmid?
Q: Describe at least three to five other limiting factors (other than the number of predators or prey) ...
A: Describe at least three to five other limiting factors (other than the number of predators or prey) ...
Q: What are the adaptations of parasitic nematodes that make them successful as endoparasites? Please i...
A: Nematodes include round worms These are free living or parasitic .Body wall is made of thick cuticl...
Q: Explain in detail what this picture shows which part? Cerebellum
A: This is a histological diagram showing various layers of cerebellum. The following image is indicati...
Q: (c) State the main function of the following: (i) Chordae tendinae (ii) Lymphocytes (iii) Seminifero...
A: A cell is the smallest unit of life. It is divided into two types: prokaryotic and eukaryotic. A cel...
Q: Which two scientists are synonymous with sterilization? O A. John Tyndall O B. Robert Bunsen O C. Mi...
A: * John Tyndall was a physicist from Ireland, who studied atmospheric conditions and climate change b...
Q: Is there a relationship between vaccines and somatic hypermutation? Elaborate.
A: "Genes" are the fundamental unit of heredity. They store genetic information in the form of DNA, whi...
Q: Define the following terms: A) substrate B) cofactor C) coenzyme D) apoenzyme E) holoenzyme
A: Enzymes These are defined as the proteins that help in speeding up metabolism and the chemical reac...
Q: 1. Explain the statement "When environmental conditions reverse, so does the selection pressure".
A: Each organism's DNA sequence is unique. Its base-pair sequence might vary from time to time. It is r...
Q: If you were asked to choose one of the following invertebrate as a pet (protozoa, sponges, and placo...
A: Protozoans *protozoans are single celled eukaryotes that lives free living or parasitic means that t...
Q: If you are using the 5 kingdom system, in which kingdom would you classify the halophiles and cyanob...
A: Five kingdom classification system was given by Robert Whittaker in 1969. He divides the diverse org...
Q: In a tabular form, compare the different biomes based on specific criteria. Follow the table format...
A: A biome is a defined area that is characterized by its flora, fauna, and climate.
Q: Question 10. Why does the sarcomere length appear to shorten (from Z line to Z line) when a muscle c...
A: The striations on muscles are formed due to a pile of sarcomeres. It encompasses the basic structure...
Q: Studying the diversity of month species in two forests calculates H' = 1.6 for forest 1 and H' = 1.1...
A: The Earth is inhabited by a variety of organisms. All organisms are classified into different phylum...
Q: If you are using the 5 kingdom system, in which kingdom would you classify the halophiles and cyanob...
A: The kingdom comprising of the simplest unicellular, prokaryotic living organisms is known as Kingdom...
Q: 3. Write down the corresponding amino acids sequence for each mRNA sequence. Use the codon chart in ...
A: Question 3 A) TAC CTA GCG CAC ATG TAG GTG GGC AAA GTT m-RNA sequence: AUG GAU CGC GUG UAC AUC CAC C...
Q: O biolistics
A:
Q: 11: All of the following are features associated with the earliest members of the genus Homo (e.g., ...
A: Features associated with Homo habilis except-
Q: A situation wherein one trait is regulated by several genes is called O multiple alleles O pleiotrop...
A: INTRODUCTION Multiple alleles:- Multiple alleles are three or more alleles for a particular gene. an...
Q: Name one respiratory structure unique and special to each of the following vertebrate animal. Briefl...
A: Cartilaginous fish Notwithstanding breath, in teleosts fish , the respiratory framework has differen...
Q: An adult mosquito has six chromosomes in each somatic cell. It mates with another adult to reproduc...
A: The minimized construction liable for pressing hereditary material by folding it over a protein comp...
Q: The two mutations we observed were ebony body and vestigial wings. Could the type of mutation affect...
A: *Ebony is a autosomal recessive trait but it is not sex linked so the F1 progeny of ebony will not b...
Q: life history of Schistosoma japonicum and Taenia solium
A:
Q: Which of the following protozoan uses flagella for locomotion? Group of answer choices dinoflagellat...
A: *protozoans are single celled eukaryotes thatare either free-living or parasitic feeds on organic m...
Q: omponents of an ecosystem include
A: Components of an ecosystem include: - Biotic Components Abiotic Components
Q: significant databthat we can obtain from grasping ideas from the connectuon of extinct organisms to ...
A: When a species becomes extinct, scientists refer to it as such. Extinction aids in the development o...
Q: Complete the tabl
A: STRUCTURAL SIMILARITIES WITH OTHER ORGANISM STRUCTURES UNIQUENESS DEVELOPMENTAL PATTERN DNA M...
Q: 5. Using the hip joint reaction force example we did in class, if the moment arm for the cane is 30 ...
A: Our body's bones offer support for their mobility. A joint is a location where two or more bones com...
Q: Which of the following sequence shows the correct hierarchy of taxonomic levels from least specific ...
A: The system of categorization of different organisms into different groups on the basis of their sign...
Q: Match the cell parts with their functions. | cristae a. support, adhesion and movement of cell b. co...
A: A cell is defined as a mass of cytoplasm which is bound externally by a cell membrane.
Step by step
Solved in 2 steps with 2 images
- 2. Shown below is the DNA sequence of a eukaryotic gene that encodes a short peptide. The sequence of the final processed mRNA synthesized from this gene is given below. Genomic DNA sequence: 5'-AGCTCATGTGCGAGTCCTGACGCTGACTAGG-3' 3'-TCGAGTACACGCTCAGGACTGCGACTGATCC-5' Processed mRNA sequence: 5'-G*UCAUGUGCGAACGCUGACUAGGAAAAAAAA....-3' In the genomic DNA sequence shown above, draw a box around each of the two exons in the gene or write the two exon sequences. а. b. In the processed mRNA above, some nucleotides are present that are not coded for in the genomic DNA sequence. Name the two processes that have occurred to add these nucleotides to the mRNA.5. A DNA sequence of "ACG" will code for the amino acid - (LS1- 1)* Second MRNA base G UUU Phe UUC UCU UAU UGU . Tyr Cys UAC Ser UAA Stop UGA Stop A UGC UUA UCA Leu UUG A E UCG UAG Stop UGG Trp G CGU 7 His CAC CUU CCU CAU AGU CUC Leu CUA CCC Pro CCA CGC Cye (C) Ang CAA CGA Gin CUG CCG CAG CGG G. A C La AUU AAU Ash AAC The AAA AGU Ser AGC ACU AUC Te ACC UG ALIA ACA AGA Arg AG AUG M ACG AAG GCU GC Val GCA GAU Asp GAC Ala GAA Slu GAG GUU GGJ GUC Gly GUA GUG GCG GGG Cys Thr Tyr Pro OIt will not code for an amino acid First mRNA base (5' end of codon) Third MRNA base (3' end of codon)3. DNA: TACGGGCCTATACGCTACTACT CA TG GATCGG MRNA: UC Codon: Anitcodon: Amino Acids: 4. DNA: G T ACGCGTATACCGACATTC MRNA: Codon: Anitcodon: Amino Acids: A8m Transcribe the following DNA strand into mRNA and translate that strand into a polypeptide chain, identifying the codons, anticodons, and amino acid sequence. DNA: CGAT ACAATGGACCCGGTATGCGATATCC DATAA
- 1. What would be the amino acid sequence encoded by the mRNA5' C C A U G A C G U C G G A U C A A U G A G C 3' 2. If the nucleotide bolded and underlined in red in part 1 changes from C to a G, what type of mutation would that be? 3. What would happen to the amino acid sequence if the C bolded in red in part 1 is changed to a G? 4. What would happen to the amino acid sequence if the C bolded in red is deleted?6. A portion of a gene is shown below. 5'-ATGATTCGCCTCGGGGCTCCCCAGTCGCTGGTGCTGCTGACGCTGCTCGTCG-3' 3'-TACTAAGCGGAGCCCCGAGGGGTCAGCGACCACGACGACTGCGACGAGCAGC-5' The sequence of the mRNA transcribed from this gene has the following sequence: 5'-AUGAUUCGCCUCGGGGCUCCCCAGUCGCUGGUGCUGCUGACGCUGCUCGUCG-3′ a. Identify the coding and noncoding strands of the DNA. b. Explain why only the coding strands of DNA are commonly published in databanks.If the first G changes to A what kind of mutation will happen? Show the change in amino acid sequence. This is base substitutions involve the replacement of one nucleotide with another. And it changes one amino acid coding, producing a missense mutation TAC CTA GCA CAC ATGTAGGTGGGCAAAGTT TAC CTA ACACACATGTAGGTGGGCAAAGTT
- DNA Sequence: TAC TCC GGC TCT CCC AGT TGA ACT Mutated Sequence: TAC TCG GCT CTC CCA GTT GAA CT Original Amino acid: Mutated Amino Acid: What mutation have occurred in the sequence? How does it affect the expression of amino acids? 2. DNA Sequence: TAC TCC GGC TCT CCC AGT TGA ACT Mutated Sequence: TAC TCT GGC TCT CCA AGT TGA ACT Original Amino acid: Mutated Amino Acid: What mutation has occurred in the sequence? How does it affect the expression of amino acids? 3. DNA Sequence: TAC TCC GGC TCT CCC AGT TGA ACT Mutated Sequence: TAC TCC GGC TCT CCC ACT TGA ACT Original Amino acid: Mutated Amino Acid: What type of mutation has occurred in the sequence? How does it affect the expression of amino acids? 4. DNA Sequence: TAC TCC GGC TCT CCC AGT TGA ACT Mutated Sequence: TAC TCC GGC TCG CCC ACT TGA ACT Original Amino acid: Mutated Amino Acid: What of mutation mutation has occurred in the sequence? How…6. Similar to the class notes (Intro to Genetics), a segment of DNA (shown below) contains a promoter segment (the first 9 base pairs), a ribosome binding segment (the next 6 base pairs), and a segment that codes for protein synthesis which is started by the rest of the base pairs. ACTCCATTGAACCATTTCTATGATCCGCTAACG-... TGAGGTAACTTGGTAAAGATACTAGGCGATTGC-... A. When the DNA is induced to be copied to mRNA, the top strand is coding, meaning that the mRNA makes an identical copy of the lower strand (replacing T with U) The mRNA copy starts with the ribosome binding sequence. What is the sequence of the mRNA that will go to the ribosomes? B. What are the first 6 amino acids of the protein that are coded for by the mRNA? C. What would the amino acid sequence be if... i. a transition mutation occurred on the final G in the mRNA? ii. all of the G & C bases in the protein synthesis portion had transition mutations? iii. a point deletion mutation occurred in the ATA sequence (in the lower strand…Sickle cell hemoglobin DNA CA CG TAGACTGAGGACA C Sickle cell hemoglobin MRNA Sickle cell hemoglobin AA sequence ValoHis.lku thro proo Gily 4. What type of mutation is this? Please explain why.
- 6. How many amino acids will the mRNA sequence "AUG GAC CUG UCG UGA" produce? (LS1-1) * Second MRNA base C. UUU Phe UUC UCU UAU UGU Cps UGC U Tyr UAC UCC Ser UCA UUA Leu UUG UAA Stop UGA Stop A Gu (G) 19) UCG UAG Stop UGG Trp G. Tye AGU A CUU CCU CAU His CAC CGU CUC Leu CUA CC CGC Cys (C) Pro CAA Gin CAG Arg CGA CCA CUG. CCG CGG Arg R AU ACU A C AAU Asn AAC Thr Le AGU Ser AGC AUC e ACC C AUA ACA Lys IK AGA Lys AGG AAA AUG M ACG AAG The GUU GCU GAU GGU Asa GAC GCC Val GCA GGC Ala Gly GUA GAA GGA Glu GSG GUG GCG GAG First mRNA base (5' end of codon) Third mRNA base (3' end of codon)If we have the following mutations, find the type of the mutation (silent or missense or nonsense?) 17C=U 36G=A 49G=U 115A=C 5’ AAACUGUGACUGAACCUCAAACCCCAAACCAGCCCGAGGAGAACCACAUUCUCCCAGGGA CCCAGGGCGGGCCGUGACCCCUGCGGCGGAGAAGCCUUGGAUAUUUCCACUUCAGAAGCC UACUGGGGAAGGCUGAGGGGUCCCAGCUCCCCACGCUGGCUGCUGUGCAGAUGCUGGACG ACAGAGCCAGGAGGGAGGCCGCCAAGAAGGAGAAGGUAGAGCAGAUCCUGGCAGAGUUCCAGC UGCAGGAGGAGGACCUGAAGAAGGUGAUGAGACGGAUGCAGAAGGAGAUGGACCGCGGCCUGA GGUAGAAGCCGCUGGGGCUUGGGGCU-3’V S X It F3 3 9999999 E D G Which letter indicates the amino end of the growing polypeptide? с F4 $ 4 A Q Search R F mRNA F5 er ge % UAC 5 V T F6 GGG AUGCCCACG G 6 B Y De F7 H ►/11 v lo & 7 7 F8 U 4 N UAG * 8 865 F9 8 1 5 G Мо Alt F10 ( 9 9 K 2 O < " ) 6 0 F11 1 P* L 3 • V A 30 F12 ; { I Ctrl = 332 PM 4/7/2023 ? + 1 } 1 11 A 1 G Backspace Home Delete Enter Shift PgUp PgDn