Please answer Which of the following correctly describes adifference between RNA & DNApolymerases?RNA polymerases usually synthesize introns,while DNA polymerases synthesize cistrons.DNA polymerases usually require a primer,while most RNA polymerases do not.RNA polymerases polymerize 5' → 3', whileDNA polymerases polymerize 3' → 5'.RNA polymerases usually do not need atemplate, while DNA polymerases do. Cell membranes typically display asymmetry.What does this mean?The fatty acyl chain on C-1 of a membranelipid is usually different from that on C-3.O Only one stereoisomer is ever seen at thechiral C-2 of the glycerol residue in amembrane lipid.The two leaves of a bilayer contain differentcollections of lipids and proteins.O Membrane lipids only have cis double bonds,never trans.

Transcription is the biological process of copying a segment of DNA into RNA, for example mRNA that…

Which of the following correctly describes a difference between RNA & DNA polymerases? RNA polymerases usually synthesize introns, while DNA polymerases synthesize cistrons. O DNA polymerases usually require a primer, while most RNA polymerases do not. RNA polymerases polymerize 5' → 3', while DNA polymerases polymerize 3'→ 5'! RNA polymerases usually do not need a template, while DNA polymerases do.

Which of the following correctly describes a difference between RNA & DNA polymerases? RNA polymerases usually synthesize introns, while DNA polymerases synthesize cistrons. O DNA polymerases usually require a primer, while most RNA polymerases do not. RNA polymerases polymerize 5' → 3', while DNA polymerases polymerize 3'→ 5'! RNA polymerases usually do not need a template, while DNA polymerases do.

Biology: The Dynamic Science (MindTap Course List)

4th Edition

ISBN:9781305389892

Author:Peter J. Russell, Paul E. Hertz, Beverly McMillan

Publisher:Peter J. Russell, Paul E. Hertz, Beverly McMillan

Chapter15: From Dna To Protein

Section: Chapter Questions

Problem 1TYK: Eukaryotic mRNA: usessnRNPs to cut out introns and seal together translatableexons. uses a...

See similar textbooks

Similar questions

Compare and contrast the properties of DNA polymerase and RNA polymerase. Drag the appropriate items to their respective bins. can proofread using a 3'-to-5' exonuclease activity polymerize in a 5'-to-3' direction Only RNA can initiate strand synthesis catalyze phosphodiester bond formation to polymerize nucleotides into nucleic acids Only DNA use deoxyribonucleotide triphosphates as substrates can only extend an existing strand Both Reset Help dependent on a DNA sequence template use ribonucleotide triphosphates as substrates
Which of the following statements are true regarding the properties of DNA and RNA polymerase. Select all that apply. Both DNA and RNA polymerase synthesize nucleic acid strands in the 5" to 3' direction. Both DNA and RNA polymerase can initiate strand synthesis on their own. I. RNA polymerase initiates strand synthesis, while DNA polymerase depends upon an existing strand to continue synthesis. II. RNA polymerase only uses ribonucleotides for strand synthesis. DNA polymerase only uses deoxyribonucleotides for strand synthesis. V. Au DNA and RNA polymerases from eukaryotes behave very differently from DNA and RNA polymerases found in prokaryotes. O VI.
Which of the following is/are required for RNA synthesis? (select all that apply) Divalent cations (e.g. Mg2+) DNA polymerase to synthesize DNA primers RNA polymerase to synthesize RNA primers dNTPs
Given the active site diagram below, please identify the residue participating in a charge-charge interation. HO OH HN OH 5 ΝΗ *HN ΝΗ OH O Zn²+ 2 4 5 3 1 2 NH 3
Which of the following statements is true? RNA polymerase can only add a nucleotide to the 5' end of a growing RNA chain. RNA polymerase can only add a nucleotide to the 3' phosphate end of a growing RNA chain. RNA polymerase can only add a nucleotide to the 5' phosphate end of a growing RNA chain. RNA polymerase can only add a nucleotide to the 3' –OH end of a growing RNA chain. none of the above is true.
Which of the following statements about RNA is/are incorrect? I. RNA strand synthesis does not occur during replication. II. All RNA strands produced during transcription are translated into proteins. III. RNA strands are composed of 10 nucleotide bases per turn. IV. RNA strands can pair with a DNA strand. V. RNA may be synthesized in the 5'-3' orientation and vice-versa (3'-5') depending on the orientation of the template DNA strand O I, II, and IV O I, II, III, IV, and V O II, IV and V O II, IV and V OI, II, III and V O Il and III
Which of the following is correct about transcription? options: The reaction is driven forward by the hydrolysis of pyrophosphate PPi -> 2Pi RNA polymerase must be able to move from nucleotide to nucleotide. Once polymerase has finished adding nucleotides, the DNA-RNA hybrid dissociates and the DNA double helix reforms. All of the above
Sensors detect the flash of light. DNA polymerase Unused deoxyribonucleotides are cleaved by apyrase. ATP is consumed by luciferase and light is emitted. AMP and PP, are converted into ATP by sulfurylase. Template strand Growing strand 3' TAGGCCTACACTTACGCGAATGT 5' 5' ATCCGGAT 3' dGTP dNTPs dNDPs dNMPs + P₁ PP₁ ATP [1]
DNA is made of two strands that are antiparallel. If one strand runs from 3’ to 5’ direction the other one will go from 5’ to 3’ direction. During replication or transcription, whatever the process is, it will always follow the 5’ to 3’ direction using the 3’ to 5’ directed strand as the template strand. Therefore, if following is the DNA sequence 5’-CCG ATC GCA CAA-3’ Using this sequence as template after transcription no protein can be translated. Why? Presence of start codon Absence of start codon Due to mutation If you want to start the translation, what change you need in the second codon (from 5’ to 3’ direction)? Substitution of C with G No change4 Deletion of Both I & III
With regard to RNA polymerase proofreading ability, which of the following is true? A 3'5' exonuclease fixes all errors in mRNA. There are specialized mRNA repair pathways that remove noncomplementary nuclec No proofreading occurs. RNA backtracking can remove noncomplementary nucleotides. RNA and DNA polymerase proofreading are essentially identical. OOOOO
Why would it be impossible for DNA splicing to occur utilizing the same mechanism as eukaryotic MRNA splicing? Spliced DNA could not be transcribed or translated DNA does not have a 3'-OH group for the initial nucleophilic attack that forms the lariat O DNA does not encode introns O DNA does not have a 2'-OH group for the initial nucleophilic attack that forms the lariat
Choose reactions that always require hydrolysis of ATP. Select all that apply. sliding along template strands unwinding of DNA strands by helicase formation of the phosphodiester linkage by DNA ligase unwinding of DNA strands by B2 subunits formation of the phosphodiester linkage by DNA polymerase I