Q: How would the H+ required to produce ATP differ in an ATP synthase that has an Fo subunit with a c r...
A: H+ produce ATP in this manner ; Low pH increases the concentration of base causing mitochondria to p...
Q: Black body (b) and purple eye (pr) are recessive autosomal mutations in Drosophila. Bridges are cros...
A: b - allele for black body - recessive pr - allele for purple eye - recessive B - wild type for body ...
Q: A glass spreader can be sterilized by dipping in 70 % ethanol and burning of excess False .a True .b
A: Introduction:- Spreaders, also known as cell spreaders, are laboratory instruments that allow sample...
Q: Which of the statements below is true about good predictions? can select more than one answer Group...
A: A good prediction is is forecast about what will happen in the future it is based on experience and ...
Q: Aside from skin (an organ), what other structures are in the integumentary system of other animals a...
A: The integumentary system is composed of organs and systems that shield the internal body from harsh ...
Q: If your body was transmitting a signal between hemispheres of the brain, the signal would travel O a...
A: If your body was transmitting a signal between hemispheres of the brain, the signal would travel A. ...
Q: The . protect the heart and lungs Your answer
A: Introduction:- The thorax, or chest cavity, houses the heart and lungs. The heart is responsible for...
Q: In your stomatal density experiment in lab, which of the following observations would lead you to fa...
A: Whenever an experimental test is performed, it is checked out for the results. When there comes out ...
Q: GENETICS 1. Which of the following does not belong? A. Seed Color B. Flower Color C. Seed Shape D....
A: 1. There were seven characters selected by Mendel for his experimental work in genetics. 2. Self- po...
Q: Did Pesticides Impair Child Development in Mexico’s Yaqui Valley?
A: The intense industrial agricultural pesticide technique was developed in the Yaqui homeland in the Y...
Q: You spread a small amount of a water sample from the environment on an enriched media agar plate. Af...
A: A tip of needle contains millions of micro-organisms, with millions of species and having different ...
Q: What are the unique anatomical structures observed in birds to carry out the functions of digestion?
A: Introduction :- Large insoluble food molecules are broken down into little water-soluble food molecu...
Q: What are the types of plant geotropisms? Why do the stem and the roots present opposite geotropisms?
A: Introduction In this question we will write the types of geotropisms and will discuss about why do t...
Q: Identify the steps involved in designing an experiment.
A: Experiments are conducted to test a particular hypothesis. Results then give a measure of how true o...
Q: what is the purpose of the nucleous ? - define diploid
A: In biology, a cell is a membrane-bound unit that holds the basic molecules of life and is made up of...
Q: Conjugation involves which of the following: a. transfer of plasmids among bacteria b. sexual rep...
A: Conjugation:Conjugation is the process of transferring genetic material from one bacteria to another...
Q: Why did Gregor Mendel choose pea plants as his experimental organism?
A: It was during the mid-nineteenth century thas headway was made in the understanding otl inheritance....
Q: Do individual organisms survive exposure to a toxic chemical because they are “mutated” by the chemi...
A: A gene is the essential physical and functional unit of heredity. They are comprised of DNA (deoxyri...
Q: How does crossing over shuffle alleles?
A: The meiosis is a cell division process that involves division of a diploid (2n) mother cell and prod...
Q: Considered less stable Whole blood is contained in a Green top tube Whole blood is contained in a Ti...
A: Plasma: Component of blood, pale yellow viscous fluid. Mainly constitute of albumin, globulin, immun...
Q: White trait refers to A. Genotype B. Gene C. Phenotype D. Polygenic Trait 2. All of the followi...
A: Phenotype It is the external and morphological appearance of an organism for a part particular chara...
Q: In Figure 6-21, propose a specific genetic explanationfor individual Q (give a possible genotype, de...
A: Examples of diseases showing an incomplete penetrance are Huntington's disease and breast cancer. Bo...
Q: List a diversity of ways some simple animals obtain nutrition without a complete digestive tract
A: Biodiversity is an integral part of the biosphere we live in and various animals shows various modes...
Q: At what stage of the culture should bacterial colonies be harvested for plasmid DNA extraction? How ...
A: Plasmid training is a way of DNA extraction and purification for plasmid DNA. Many techniques were e...
Q: Answer the following: 1. Which pieces of DNA are the most informative? Why? 2. Explore the concept o...
A: Note: Ad per Bartleby Guidelines, For Remaining Answers Please Repost The Question. Introduction: DN...
Q: What are the main types of waste?
A: Introduction Organic waste, recyclable waste, non-recyclable waste, toxic waste, nuclear toxic waste...
Q: Explain about the following picture, which represents the heart
A: The given picture is a Histology slide of a Cardiac muscle.
Q: What is biology
A: Biology deals with living organisms and their various processes. It is a natural science discipline.
Q: What can you observe when you view a Gram stained-mixture of bacterial specimen?
A: Gram-staining is a technique that helps us to differentiate between Gram-negative and Gram-positive ...
Q: :In bacterial culture media, agar is used as An additional nutrient .a Buffer .b A solidifying agent...
A: Agar is used in laboratory to help, feed and grow microorganisms. It is used in laboratory for exper...
Q: Four E. coli strains of genotype atb¯ are labeled 1, 2, 3, and 4. Four strains of genotype a¯b* are ...
A: Introduction :- Escherichia coli (E. coli) is a type of bacteria that can be found in the environmen...
Q: Which of the following results in green output in spectrophotometry experiment? a. Violet light b....
A: Spectrophotometry: it is used for quantitative analysis of spectra of various wavelengths to compare...
Q: Can you tell me about the contribution of Don Francis in the society's knowledge about HIV?
A: AIDS is an Acquired Immune disorder syndrome that is caused by HIV (Human Immuno deficiency virus). ...
Q: Meaningful evolution occurs when __________. ○ a heritable trait affects survival and fitness ○ a ...
A: Evolution is the change in the characteristics of a species over several generations and relies on t...
Q: Meiosis produces daughter cells that are mitosis produces daughter cells that are diploid / diploid ...
A: Introduction : Meiosis - it's a cell division process occurs in germ cells. In meiosis from a dip...
Q: Why is PCR beneficial?
A: INTRODUCTION The Polymerase Chain Reaction (PCR) was formerly originated by American B...
Q: ing the following DNA sequence determine the amino acid sequence: AGAGGTCCGCGTTTAGACAT5' et Val Ser ...
A: Complementary strand of RNA is formed by complementary base pairing that occurs between adenine and ...
Q: A gardener harvested 3,697 seeds from cross breeding a pure line red-flower petunia and pure line wh...
A: The characteristic that initially shows up or is shown in the organism is known as the dominant trai...
Q: Q:-What is neoplasia?
A: Introduction In this question we will discuss about the Neoplasia.
Q: how they can affect the populations
A: Ecology at the organismic level is essentially physiological ecology which tries to understand how d...
Q: Which of the following is NOT one of the roles of algae in nature? O a. Petroleum is the fossil rema...
A: Introduction : Features of algae : Body is relatively simple unicellular or multicellular thallus ...
Q: Using any search engine, look for at least three (3) processes of Plants and Animals: reproduction, ...
A: Both animals and plants uses various organ systems to perform different functions for their survival...
Q: There are two types of alleles: Type B1 and Type B2 (In total there are 10) Type B1 has 6 Type B2 ha...
A: Introduction : Here, B1 allele = p = homogygous dominant allele B2 allele = q = homogy...
Q: why is recombinant DNA is possible becuase we know dna molecules from all organisms share the same c...
A: Yes, it is true that all organisms indeed share the same basic structure of all molecules. But by ev...
Q: RECOMBINANT DNA • Recombinant DNA molecules are sometimes called chimeric DNA. • The DNA sequences u...
A: Recombinant DNA technology is very commonly used in laboratories that is responsible for the inserti...
Q: please help 2 questions 1) how can you tell the difference between male and female fruit fly? 2) ...
A: fruit fly also called drosophila melanogaster is an extensively studied fly for genetically linked t...
Q: In what ways are mitosis and meiosis different?
A: The fundamental and active biological process by which a parent cell, after replication of it's comp...
Q: Meiosis produces daughter cells that are ; while mitosis produces daughter cells that are O Similar ...
A: Meiosis produces daughter cells that are very different from each other and from the parent cell ; w...
Q: in your own words, describe the squash soup in terms of appearance, color, size, shape, texture (fi...
A: Squash soup is made from a wide varieties of squash which provides it a appetizing flavor. Along wit...
Q: When comparing evolutionary similarities between different genes within a gene family, it is usually...
A: Genes are the basic units of inheritance in living organisms. They are passed down from parents to t...
Why are the elements found in the I=P x A x T important in terms of them having an impact to our environment?
Trending now
This is a popular solution!
Step by step
Solved in 3 steps
- Compound A has molecular formula C7H7X. Its 1H-NMR spectrum shows a singlet at 2.25 ppm and two doublets, one at 7.28 ppm and one at 7.39 ppm. The singlet has an integral of three and the doublets each have an integral of two. The mass spectrum of A shows a peak at m/z = 126 and another peak at m/z = 128; the relative height of the two peaks is 3:1 respectively. Identify what atom X is, explaining your reasoning and identify Compound A, explaining your reasoning.In which of the following pairs is the first element expected to have a higher electronegativity than the second? (1 Point) O O, P O Cs, Rb O I, Br Al, PThe six elements that make up biomolecules aren't the six most prevalent elements on Earth. What are these 6 elements and discuss why the biomolecules' abundance isn't a factor to consider. What characteristics do these elements possess that enable them to better perform their responsibilities in the production of life-sustaining molecules?
- Fill out Table 1 above by writing “+” if the compound tested positive for the chemical reaction. Otherwise, write “-“Consider these compounds: A. PbBr, B. MnS C. Ag,CO3 D. AIPO, Complete the following statements by entering the letter(s) corresponding to the correct compound(s). (If more than one compound fits the description, include all the relevant compounds by writing your answer as a string of characters without punctuation, e.g, ABC.) Without doing any calculations it is possible to determine that magnesium fluoride is more soluble than and magnesium fluoride is less soluble than| It is not possible to determine whether magnesium fluoride is more or less soluble than by simply comparing Kgp values.Another major use of bismuth has been as an ingredient in low-melting metal alloys, such as those used in firesprinkler systems and in typesetting. The element itself is a brittle white crystalline solid. How do these characteristicsfit with the fact that bismuth is in the same periodic group with such nonmetallic elements as nitrogenand phosphorus?
- Atoms A and B interact to form a compound, AB2. When measured, atom A has a partial negative charge and atom B has a partial positive charge. From this information, we can conclude what? Select only ONE answer choice. Note: - means "approximately equal to" , A > B means "A is greater than B" , and A B: AB2 is hydrophilic Not enough information to answer the questionWhat are Alu elements? How can they adversely affect human health?What three things constitute the ocean (Hint: one of them is water)? Why is this fact important? How do sodium atoms and chlorine atoms combine to make the salt in the ocean?