Human Heredity: Principles and Issues (MindTap Course List)
11th Edition
ISBN: 9781305251052
Author: Michael Cummings
Publisher: Cengage Learning
expand_more
expand_more
format_list_bulleted
Concept explainers
Videos
Textbook Question
Chapter 10, Problem 20QP
If an extra
Expert Solution & Answer
Want to see the full answer?
Check out a sample textbook solution
Students have asked these similar questions
Given the following DNA, (A) what is the transcript (MRNA) sequence? (B)
What might be the amino acid sequence of the translated protein?
5'– ATGGCGAGGCGGCAGCTGTTATGGTGA – 3'
How does the cell ensure that a specific amino acid (say, valine) attaches itself only to the one tRNA molecule that is specific for valine?
(A) Proteins called aminoacyl DNA synthetases are responsible for bringing together the proper pair. The enzymes match the amino acid and one of the correct DNA molecules carrying the right anticodon.
(B) Lipids called aminoacyl tRNA synthetases are responsible for bringing together the proper pair. The lipid binds the amino acid and one of the correct tRNA molecules carrying the right codon.
(C) Enzymes called aminoacyl tRNA synthetases are responsible for bringing together the proper pair. The enzymes match the amino acid and one of the correct tRNA molecules carrying the right anticodon.
(D) Enzymes called peptidyl mRNA synthetases are responsible for bringing together the proper pair. The enzymes match the amino acid and one of the correct mRNA molecules carrying the right anticodon.
A segment of DNA has the followimg sequence of bases..
5'-ATGCAATGATATTGAAGCTTA-3'
a) What sequence of bases would appear in mRNA transcribed from this segment?
b) Assume the first base in this mRNA is the beginning of a codon. What order of amino acid would be translated into a polypeptide synthesized along this segment?
c) Give anticodons for each tRNA associated with the translation in part (b)
Chapter 10 Solutions
Human Heredity: Principles and Issues (MindTap Course List)
Ch. 10.4 - Prob. 1GRCh. 10.4 - Prob. 2GRCh. 10.7 - Prob. 1EGCh. 10.7 - Prob. 2EGCh. 10 - A couple was referred for genetic counseling...Ch. 10 - A couple was referred for genetic counseling...Ch. 10 - A couple was referred for genetic counseling...Ch. 10 - Many individuals with metabolic diseases are...Ch. 10 - Prob. 2QPCh. 10 - Enzymes have all the following characteristics...
Ch. 10 - Questions 4 through 6 refer to the following...Ch. 10 - Questions 4 through 6 refer to the following...Ch. 10 - Prob. 6QPCh. 10 - Prob. 7QPCh. 10 - Prob. 8QPCh. 10 - a. Compounds A, B, C, and D are known to be...Ch. 10 - b. Compounds A, B, C, and D are known to be...Ch. 10 - a. If an individual who is homozygous for the...Ch. 10 - Prob. 12QPCh. 10 - Suppose that in the formation of phenylalanine...Ch. 10 - If phenylalanine was not an essential amino acid,...Ch. 10 - Phenylketonuria and alkaptonuria are both...Ch. 10 - The normal enzyme required for converting sugars...Ch. 10 - Knowing that individuals who are homozygous for...Ch. 10 - Prob. 18QPCh. 10 - A person was found to have very low levels of...Ch. 10 - If an extra nucleotide is inserted in the first...Ch. 10 - Transcriptional regulators are proteins that bind...Ch. 10 - Prob. 22QPCh. 10 - Prob. 23QP
Knowledge Booster
Learn more about
Need a deep-dive on the concept behind this application? Look no further. Learn more about this topic, biology and related others by exploring similar questions and additional content below.Similar questions
- A normal hemoglobin protein has a glutamic acid at position 6; in sickle-cell hemoglobin, this glutamic acid has been replaced by a valine. List all the possible mRNA codons that could be present for each type of hemoglobin. Can a single base change result in a change from Glu to Val in hemoglobin?arrow_forwardBreast cancer can be caused by a genetic mutation on the BRCA1 gene changing a methionine to an arginine residue in the transcribed protein. How will this mutation effect this protein? a) Polarity before and after mutation: b) Size of the region before and after the mutation: c) Tertiary interaction you would expect with substrate: d) Name an amino acid that the unaffected protein's methionine could interact:arrow_forwardA polypeptide has the following sequence: Phe-Pro-Lys-Gly. Which of the following sequences in the coding strand of the DNA could code for this peptide? Select all that are correct. A) CTT-GGG-AAA-CCC-TAG B) TTC-CCG-AAG-GGA C) TTT-CCC-AAA-GGG-TGA D) UUC-CCA-AAG-GGU E) TTC-CCA-AAG-GGC F) AAA-GGG-TTT-CCC-ATTarrow_forward
- Which statement is false: A) Each type of protein ( ex: hemoglobin vs trypsionngen) varies in the length and amino acid sequence of its peptide B) After the rpocess of transcription is complete, the mRNA that is produced will continue being tranlsated by ribosomes for the rest of the cells life. mRNA never breaks down C) A ribosome will bind to an mRNA and will translate the sequence by reading one codon at a time and adding one amino acid to the peptide chain. It will stop the translation once it encounters a stop codon D) The gene for a protein provides the information on the legth of the peptide, along w the amino acid sequence so the protein can be synthesized by a ribosome E) Once mRNA has left the nucleus, ribosomes will bind to it and will follow the instructions in its sequence to make the new protienarrow_forwarda) Identify three types of RNA and provide a description of each and the role they play in protein synthesis. (6 marks) b) Use the DNA sequence below to answer the following questions. 3' - TACGAACGAGTGCCCCAAAATT -5' What is the complementary DNA strand? (1 mark) What is the nucleotide sequence of the mRNA strand transcribed from the initial DNA strand? (1 mark) Provide an alternative mRNA sequence with four changes that would translate to the same amino acid sequence. (2 marks) Paragraph I A + v ... Lato (Recom... v 19px ... v Add a File Record Audio Record Video MacBook Pro G Search or type URL #3 2$ & ( 3 4 7 8 9 山訓 < COarrow_forwardSickle cell anemia is a widespread disease in many African countries and can be caused by a change in the amino acid sequence from glutamic acid to valine. A patient is diagnosed with the disease and a genetic fingerprint reveals the following DNA sequence for the gene: (a) (b) (c) (d) (e) Write down the mRNA sequence for the given DNA sense strand indicating the polarity. Derive the polypeptide from the mRNA molecule using the table of the genetic code (Table Q1 below) again indicating the polarity of the peptide chain. Indicate the position in the DNA molecule that could have caused the disease and write down all possible point mutations in the DNA sequence that could have caused it. [ The polypeptide chain is polymerized at the ribosomes using t-RNA molecules. Write down all possible t-RNA molecules with their anti-codons that are used to polymerize the amino acid VAL. Indicate the polarity. 3'-TAC TGA GCA AGA TTA CAT ACT-5' Explain what is meant by redundancy of the genetic code.…arrow_forward
- (b) Hemoglobin is made of B-globin subunits. The first few mRNA nucleotides for B- globin are given by: (1) (iii) (iv) Write down the DNA sequence that has led to this mRNA and indicate the sense and non-sense strands and the polarity. CE Derive the polypeptide for the sequence using the table of the genetic code (Table Q1 below) and indicate the polarity of the polypeptide chain. First Position (5' end) U A single point mutation in mRNA sequence can cause sickle cell anemia by changing the amino acid Glu to Val. For the given mRNA, indicate the point mutations for the first Glu in the polypeptide sequence that can cause this disease. 5'-AUGGUCCACCUGACUCCUGAGGAGAAG...UGA-3' C The polypeptide of B-globin contains the amino acid Leu. Write down all the anticodons of the tRNA molecules that can potentially code for Val. Indicate the polarity of the anti-codon. A G Table 1. The Codons of the Genetic Code Second Position U Phe Phe Leu Leu Leu Leu Leu Leu Ile Ile Ile Met-Start Val Val Val…arrow_forwardCystic fibrosis (CF) is an inherited disorder caused by different types of mutations, many of which prevent ions from moving across cell membranes. Normally there are channel proteins that allow passage of the ions, but in patients with one kind of CF these proteins seem odd. Closer examination shows that these proteins display the correct amino acid sequence. However, they fail to do their job. A) Given that the primary structure of the protein is correct, what can you infer about the DNA sequence for the gene coding this protein on this patient, is there a mutation? Explain. B) Why is the primary structure insufficient to guarantee the proper function of the protein?arrow_forwardFor translation of eukaryotic mRNA sequences: a) The stop codon stops translation by blocking the ribosome. b) The tRNA is the same thing as the amino acid. c) There are two binding pockets within the ribosome where different tRNAs will bind to the mRNA. d) The first codon that is recognized by the ribosome is UAG e) The ribosome can bind to the mRNA in any location.arrow_forward
- Sickle cell disease is caused by a so-called “point mutation" in the human B-globin gene. A point mutation is the result of a single base substitution in the DNA encoding a gene. The sickle cell mutation results in substitution of Val for Glu at position 6 in the B-globin protein. (a) Using the information in Figure 5.18 explain how a point muta- tion could change a codon for Glu to a codon for Val. (b) Do you expect the pI for the sickle cell B-globin to be higher or lower than the pl for wild-type B-globin? Explain.arrow_forwardThe amino acid sequence for a short peptide is Tyr-Leu-Thr-Ala. What are the possible base sequences of the mRNA and the transcribed DNA strand that code for it? What are the anticodons?arrow_forwardA gene contains 141 codons. How many nucleotides are present in the gene’s coding sequence? How many amino acids are expected to be present in the polypeptide encoded by this gene?arrow_forward
arrow_back_ios
SEE MORE QUESTIONS
arrow_forward_ios
Recommended textbooks for you
Human Heredity: Principles and Issues (MindTap Co...BiologyISBN:9781305251052Author:Michael CummingsPublisher:Cengage Learning
Human Heredity: Principles and Issues (MindTap Co...
Biology
ISBN:9781305251052
Author:Michael Cummings
Publisher:Cengage Learning
Biomolecules - Protein - Amino acids; Author: Tutorials Point (India) Ltd.;https://www.youtube.com/watch?v=ySNVPDHJ0ek;License: Standard YouTube License, CC-BY