Biology
5th Edition
ISBN: 9781260487947
Author: BROOKER
Publisher: MCG
expand_more
expand_more
format_list_bulleted
Concept explainers
Textbook Question
Chapter 13, Problem 2CQ
What is RNA interference (RNAi)? Explain how the double-stranded RNA is processed during RNAi and how it leads to the silencing of a complementary mRNA.
Expert Solution & Answer
Want to see the full answer?
Check out a sample textbook solutionStudents have asked these similar questions
Many uridine molecules are inserted into some mitochondrial mRNAs in trypanosomes. The uridine residues come from the poly(U) tail of a donor strand. Nucleoside triphosphates do not participate in this reaction. Propose a reaction mechanism that accounts for these findings. (Hint: Relate RNA editing to RNA splicing.)
Introns are often very large and the cell has devoted mechanisms of eliminating them once they are excised from the pre-mRNA. Following intron excision, what specific ribonucleolytic enzymes or complexes contribute to eliminating the intron RNA immediately after it is excised from the pre-mRNA? Briefly describe the role of each step/enzyme and how it affects its RNA substrate
Draw the SMN2 pre-mRNA (10 exons and 9 introns), indicate the 5’ and 3’ SS location.
Draw the SMN2 mature mRNA before treatment with Spinraza. What type of alternative splicing is occurring?
Draw the SMN2 mature mRNA after treatment with Spinraza
Chapter 13 Solutions
Biology
Ch. 13.1 - Prob. 1CCCh. 13.2 - Prob. 1CCCh. 13.3 - Prob. 1EQCh. 13.3 - Prob. 2EQCh. 13.3 - Prob. 3EQCh. 13.3 - Effects of Non-coding RNAs on Translation and mRNA...Ch. 13.4 - Non-coding RNAs and Protein Sorting Core Skill:...Ch. 13.5 - Core Skill: Modeling The goal of this modeling...Ch. 13 - Prob. 1TYCh. 13 - Prob. 2TY
Ch. 13 - Prob. 3TYCh. 13 - Prob. 4TYCh. 13 - Prob. 5TYCh. 13 - Prob. 6TYCh. 13 - With regard to miRNAs and siRNAs, which of the...Ch. 13 - Cas1 and Cas2 proteins play a role during which of...Ch. 13 - Which of the following components bind to...Ch. 13 - Abnormalities in the expression of ncRNAs are...Ch. 13 - An ncRNA may have one or more of the following...Ch. 13 - What is RNA interference (RNAi)? Explain how the...Ch. 13 - Prob. 3CQCh. 13 - Prob. 1COQCh. 13 - Go to the PubMed website and search for non-coding...
Knowledge Booster
Learn more about
Need a deep-dive on the concept behind this application? Look no further. Learn more about this topic, biology and related others by exploring similar questions and additional content below.Similar questions
- RNA silencing can be accomplished by specific mRNA degradation or by preventing its translation of the encoded protein. What specific determines which of these two pathways will be followed? It depends on whether the RITS or the RISC complex associates with double-stranded RNA. It depends on whether the single-stranded RNA, associated with RISC, base-pairs perfectly or imperfectly with the target mRNA. It depends on whether Drosha is involved in the process. It depends on whether Dicer is associated with single- or double-stranded RNA. It depends on whether RISC initially binds to single- or double-stranded RNA.arrow_forwardRNA silencing can be accomplished by specific MRNA degradation or by preventing its translation of the encoded protein. What specifically determines which of these two pathways will be followed? OIt depends on whether Drosha is involved in the process. OIt depends on whether Dicer is associated with single- or double-stranded RNA It depends on whether the single-stranded RNA, associated with RISC, base-pairs perfectly or imperfectly with the target MRNA. It depends on whether the RITS or the RISC complex associates with double-stranded RNA. It depends on whether RISC Initially binds to single- or double-stranded RNA.arrow_forwardIf an antisense RNA is designed to silence the following mRNA sequence, which of the following antisense oligos (a-d) could be used for this purpose? mRNA sequence: 5' UAGGACUAUUAAGGUACACCCAUU 3' O 5' AUCCUGAUAAUUCCAUGUAAAUAA 3' O 5' AAUGGGUGUACCUUAAUAGUCCUA 3' O 5' UAGGACUAUUAAGGUACACCCAUU 3' O 5' UUACCCACAUGGAAUUAUCAGGAU 3¹arrow_forward
- What is mean by RNA editing ?arrow_forwardDefine RNA interference (RNAi).arrow_forwardWhat is the total size of the mature i.e. fully processed mRNA in nucleotides? How many amino acids would the encoded protein be? Assume that the N- terminal Met encoded by the AUG start codon, is NOT cleaved from the protein?arrow_forward
- A normal mRNA that reads 5’ – UGCCAUGGUAAUAACACAUGAGGCCUGAAC– 3’ has an insertion mutation that changes the sequence to 5’ -UGCCAUGGUUAAUAACACAUGAGGCCUGAAC– 3’. Translate the original mRNA and the mutated mRNA, and explain how insertion mutations can have dramatic effects on proteins. (Hint: Be sure to find the initiation site.)arrow_forward) A normal mRNA that reads 5'- UGCCAUGGUAAUAACACAUGAAGGCCUGAAC-3' was an insertion mutation that changes the sequence to 5'- UGCCAUGGUUAAUAACACAUGAGGCGUGAAC-3'. Translate the original mRNA and the mutated mRNA and explain how insertion mutations can have dramatic effects on proteins. ( Hint; Be sure to find the initiation site).arrow_forwardDraw the SMN2 mature mRNA before treatment with Spinraza. What type of alternative splicing is occurring?arrow_forward
- Define RNA interference (RNAi) mechanism ?arrow_forwardWhat is a functional consequence of RNA editing?arrow_forwardProkaryotic mRNAs have a RBS (Ribosomal binding site). How they use RBS for translational machinery? What are the properties of RBS? Draw a simple scheme for RBS and mRNA interaction site.arrow_forward
arrow_back_ios
SEE MORE QUESTIONS
arrow_forward_ios
Recommended textbooks for you
- Human Anatomy & Physiology (11th Edition)BiologyISBN:9780134580999Author:Elaine N. Marieb, Katja N. HoehnPublisher:PEARSONBiology 2eBiologyISBN:9781947172517Author:Matthew Douglas, Jung Choi, Mary Ann ClarkPublisher:OpenStaxAnatomy & PhysiologyBiologyISBN:9781259398629Author:McKinley, Michael P., O'loughlin, Valerie Dean, Bidle, Theresa StouterPublisher:Mcgraw Hill Education,
- Molecular Biology of the Cell (Sixth Edition)BiologyISBN:9780815344322Author:Bruce Alberts, Alexander D. Johnson, Julian Lewis, David Morgan, Martin Raff, Keith Roberts, Peter WalterPublisher:W. W. Norton & CompanyLaboratory Manual For Human Anatomy & PhysiologyBiologyISBN:9781260159363Author:Martin, Terry R., Prentice-craver, CynthiaPublisher:McGraw-Hill Publishing Co.Inquiry Into Life (16th Edition)BiologyISBN:9781260231700Author:Sylvia S. Mader, Michael WindelspechtPublisher:McGraw Hill Education
Human Anatomy & Physiology (11th Edition)
Biology
ISBN:9780134580999
Author:Elaine N. Marieb, Katja N. Hoehn
Publisher:PEARSON
Biology 2e
Biology
ISBN:9781947172517
Author:Matthew Douglas, Jung Choi, Mary Ann Clark
Publisher:OpenStax
Anatomy & Physiology
Biology
ISBN:9781259398629
Author:McKinley, Michael P., O'loughlin, Valerie Dean, Bidle, Theresa Stouter
Publisher:Mcgraw Hill Education,
Molecular Biology of the Cell (Sixth Edition)
Biology
ISBN:9780815344322
Author:Bruce Alberts, Alexander D. Johnson, Julian Lewis, David Morgan, Martin Raff, Keith Roberts, Peter Walter
Publisher:W. W. Norton & Company
Laboratory Manual For Human Anatomy & Physiology
Biology
ISBN:9781260159363
Author:Martin, Terry R., Prentice-craver, Cynthia
Publisher:McGraw-Hill Publishing Co.
Inquiry Into Life (16th Edition)
Biology
ISBN:9781260231700
Author:Sylvia S. Mader, Michael Windelspecht
Publisher:McGraw Hill Education
DNA vs RNA (Updated); Author: Amoeba Sisters;https://www.youtube.com/watch?v=JQByjprj_mA;License: Standard youtube license