Prescott's Microbiology
11th Edition
ISBN: 9781260211887
Author: WILLEY, Sandman, Wood
Publisher: McGraw Hill
expand_more
expand_more
format_list_bulleted
Concept explainers
Textbook Question
Chapter 15.5, Problem 3CC
Retrieve, Infer, Apply
How are cis-encoded RNAs, micro RNAs, and small interfering RNAs alike? How do they differ? What other non-coding RNAs can affect protein synthesis in eukaryotes?
Expert Solution & Answer
Want to see the full answer?
Check out a sample textbook solutionStudents have asked these similar questions
m-RNA analysis
How How to protect the messenger RNA from lysis by proteases?
Give typed full explanation
Given the following sequence of RNA, propose the potential hairpin structure for this RNA. Indicate base pairing with a dotted line. 5’ -AGGACCCUUCGGGGUUCU-3’
Why is yeast RNA insoluble in cold water, ethanol and HCl?
And why yeast RNA soluble in hot water and ethanol?
Chapter 15 Solutions
Prescott's Microbiology
Ch. 15.2 - Prob. 1CCCh. 15.2 - Prob. 2CCCh. 15.2 - Prob. 3CCCh. 15.2 - Prob. 4CCCh. 15.2 - Prob. 5CCCh. 15.3 - What functions are served by the 5 cap and the 3...Ch. 15.3 - Retrieve, Infer, Apply What elements in archaeal...Ch. 15.3 - Prob. 2CCCh. 15.3 - Prob. 3CCCh. 15.4 - Prob. 1CC
Ch. 15.4 - Prob. 2CCCh. 15.4 - Prob. 3CCCh. 15.5 - Retrieve, Infer, Apply List two similarities and...Ch. 15.5 - Prob. 2CCCh. 15.5 - Retrieve, Infer, Apply How are cis-encoded RNAs,...Ch. 15 - Prob. 1RCCh. 15 - Prob. 2RCCh. 15 - Prob. 3RCCh. 15 - Prob. 4RCCh. 15 - Prob. 5RCCh. 15 - Prob. 6RCCh. 15 - Prob. 7RCCh. 15 - Prob. 8RCCh. 15 - Prob. 9RCCh. 15 - Prob. 1ALCh. 15 - All of the subunits in bacterial RNA polymerases...Ch. 15 - Would you expect that one day microbiologists...Ch. 15 - In the chapter opening story, it was stated that...Ch. 15 - Prob. 5AL
Knowledge Booster
Learn more about
Need a deep-dive on the concept behind this application? Look no further. Learn more about this topic, biology and related others by exploring similar questions and additional content below.Similar questions
- Need help:, The rRNAs are isolated from the large subunit of a bacterial ribosome and separated by density gradient centrifugation. Draw the resulting density gradient and label the bands observed. Which rRNA is longest?arrow_forwardDesign an oligonucleotide-based affi nity chromatography system for purifying mature mRNAs from eukaryotic cell lysates.arrow_forwardGTTTTCACTGGCGAGCGTCATCTTCCTACT 1. Identify the gene from which the query sequence originates (Name of the gene)2. Provide the FULL protein sequence encoded by the gene.3. Are different splice variants known for this gene?4. What human disease has been connected to this gene?5. Calculate molecular weight (kiloDalton, kD) and calculated pI (the pH where theprotein carries no net electrical charge) of the protein.6. Provide the reference (in proper reference form: Author; Year; Title; JournalName; Volume; Page Numbers) for a recent publication involving the identifiedgene. This reference should NOT be a web page reference.7. Are there homologs for the identified gene in other systems? Identify one homolog in an invertebrate system (if there is none, provide a vertebratehomolog).8. What is the function (e.g. transcriptional regulation, transmembrane signaling,kinase, protease, etc.) of the protein(s) encoded by the gene.9. Generate a FULL protein sequence alignment for one of the…arrow_forward
- What was studied or investigated in the paper? Who would be affected by this? https://opus.lib.uts.edu.au/bitstream/10453/31887/1/2012007630OK.pdfarrow_forwardHow was the enzyme that makes RNA within the cell found, initially discovered to have two components, and the roles of these components? Discuss the protocols for column chromatography, electrophoresis, and in-vitro RNA synthesis.arrow_forwardSuppose your supervisor is working on a molecule “X” with UniProtKB accession number P18564. Being a team member in the project, you have been asked to provide the following information with high accuracy? I. Chromosome number: II. Protein size: III. Number of exons: IV. Stop codon: V. Size of the longest exon in nucleotidesarrow_forward
- Can Bioinformatics be used for sequence annotation to identifyprotein-coding and noncoding sequences of a gene ? If yes then explain how ?arrow_forwardWhat is the functional significance of sticky ends in a cloningexperiment?What type of bonding makes the ends sticky?arrow_forwardExplain the Molecular Techniques for Analyzing RNA ?arrow_forward
- Sequence1 TCGAAATAACGCGTGTTCTCAACGCGGTCGCGCAGATGCCTTTGCTCATCAGATGCGACCGCAACCACGTCCGCCGCCTTGTTCGCCGTCCCCGTGCCTCAACCACCACCACGGTGTCGTCTTCCCCGAACGCGTCCCGGTCAGCCAGCCTCCACGCGCCGCGCGCGCGGAGTGCCCATTCGGGCCGCAGCTGCGACGGTGCCGCTCAGATTCTGTGTGGCAGGCGCGTGTTGGAGTCTAAA *edited sequence: 1) according to BLAST what is the probable identity of this sequence? 2) what organism does the sequence probably come from genus and species? 3) what is the E value for this sequence ? 4) what is the accession number for this sequenarrow_forwardSequence: CCACCTGTACCCGGACACACCCTGGTGTCC 1. Identify the gene from which the querysequence originates (Name of gene) 2. Provide the FULLprotein sequence encoded by the gene. 3. Are different splice variants known for this gene? 4. What human disease has been connected to this gene? 5. Calculate molecular weight (kiloDalton, kD) and calculated pI (the pH where the protein carries no net electrical charge) of the protein.arrow_forwardMass spectrometry is a powerful tool in proteomics. What are the four key features of a mass spectrometer? Describe briefly how MALDI and two-dimensional polyacrylamide gel electrophoresis could be used to identify a protein expressed in cancer cells but not in normal healthy cells.arrow_forward
arrow_back_ios
SEE MORE QUESTIONS
arrow_forward_ios
Recommended textbooks for you
- Biology: The Dynamic Science (MindTap Course List)BiologyISBN:9781305389892Author:Peter J. Russell, Paul E. Hertz, Beverly McMillanPublisher:Cengage LearningHuman Heredity: Principles and Issues (MindTap Co...BiologyISBN:9781305251052Author:Michael CummingsPublisher:Cengage LearningBiochemistryBiochemistryISBN:9781305961135Author:Mary K. Campbell, Shawn O. Farrell, Owen M. McDougalPublisher:Cengage Learning
Biology: The Dynamic Science (MindTap Course List)
Biology
ISBN:9781305389892
Author:Peter J. Russell, Paul E. Hertz, Beverly McMillan
Publisher:Cengage Learning
Human Heredity: Principles and Issues (MindTap Co...
Biology
ISBN:9781305251052
Author:Michael Cummings
Publisher:Cengage Learning
Biochemistry
Biochemistry
ISBN:9781305961135
Author:Mary K. Campbell, Shawn O. Farrell, Owen M. McDougal
Publisher:Cengage Learning
QCE Biology: Introduction to Gene Expression; Author: Atomi;https://www.youtube.com/watch?v=a7hydUtCIJk;License: Standard YouTube License, CC-BY