Biology (MindTap Course List)
11th Edition
ISBN: 9781337392938
Author: Eldra Solomon, Charles Martin, Diana W. Martin, Linda R. Berg
Publisher: Cengage Learning
expand_more
expand_more
format_list_bulleted
Concept explainers
Question
Chapter 16.2, Problem 4C
Summary Introduction
To determine: The types of chemical modifications occurring in DNA or histones that result in genomic imprinting.
Introduction: Humans inherit alleles one from father and one from mother. Both alleles are generally functional but in some cases, one is turned off that do not express in the offspring. This refers to the gene that is imprinted, that is, the gene from one parent is silenced and is expressed from the other parent.
Expert Solution & Answer
Want to see the full answer?
Check out a sample textbook solutionStudents have asked these similar questions
Elaborate on the significance of DNA packaging in the inheritance and transmission of traits.
• Describe one effect of a Cas (CRISPR-Associated) protein on DNA
molecules.
How were we able to detect if the CRISPR-Cas9 experiment performed on
butterflies was successful?
Why did many bacteria acquire CRISPR-Cas systems in the process of
evolution?
. Discuss what message does a gene provide? How is the language of the geneexpressed?
Chapter 16 Solutions
Biology (MindTap Course List)
Ch. 16.1 - Distinguish between karyotyping and pedigree...Ch. 16.1 - Prob. 2LOCh. 16.1 - Prob. 3LOCh. 16.1 - Prob. 1CCh. 16.1 - Prob. 2CCh. 16.1 - Describe two ways in which genome database...Ch. 16.1 - Prob. 4CCh. 16.2 - Explain how nondisjunction in meiosis is...Ch. 16.2 - Distinguish among the following structural...Ch. 16.2 - Prob. 6LO
Ch. 16.2 - VISUALIZE Draw a simple sketch illustrating how...Ch. 16.2 - Prob. 2CCh. 16.2 - Prob. 3CCh. 16.2 - Prob. 4CCh. 16.3 - State whether each of the following genetic...Ch. 16.3 - Which of the following genetic diseases is/are...Ch. 16.3 - Prob. 2CCh. 16.3 - Prob. 3CCh. 16.4 - Briefly discuss the process of gene therapy,...Ch. 16.4 - Prob. 1CCh. 16.5 - State the relative advantages and disadvantages of...Ch. 16.5 - Distinguish between genetic screening programs for...Ch. 16.5 - Prob. 1CCh. 16.5 - Prob. 2CCh. 16.6 - Prob. 11LOCh. 16.6 - Prob. 1CCh. 16.6 - CONNECT To be expressed, an autosomal recessive...Ch. 16.6 - Prob. 3CCh. 16 - Prob. 1TYUCh. 16 - An abnormality in which there is one more or one...Ch. 16 - The failure of chromosomes to separate normally...Ch. 16 - Prob. 4TYUCh. 16 - Prob. 5TYUCh. 16 - Prob. 6TYUCh. 16 - Prob. 7TYUCh. 16 - Prob. 8TYUCh. 16 - Examine the following pedigrees. Which is the most...Ch. 16 - Examine the following pedigrees. Which is the most...Ch. 16 - Prob. 11TYUCh. 16 - SCIENCE, TECHNOLOGY, AND SOCIETY Imagine that you...Ch. 16 - A common belief about human genetics is that an...Ch. 16 - Prob. 14TYUCh. 16 - EVOLUTION LINK Explain some of the evolutionary...
Knowledge Booster
Learn more about
Need a deep-dive on the concept behind this application? Look no further. Learn more about this topic, biology and related others by exploring similar questions and additional content below.Similar questions
- • Inversions may affect the function of genes at or near a_______ by splitting a gene and disrupting its function,or by altering its regulation.arrow_forwardWhy is the control of gene expression important for cells? Choose one: It ensures the accurate replication of DNA. It prevents mutations from occurring during transcription and translation. • It regulates the synthesis of proteins necessary for cellular functions.arrow_forwardIllustrate about the Map and sequence the genomes of several model organisms used in experimental genetics, including Escherichia coli, Saccharomyces cerevisiae, Caenorhabditis elegans, Drosophila melanogaster, and Mus musculus (mouse).arrow_forward
- • Whether a mutation is recessive or dominant to wild typedepends on how drastically the protein product is alteredand how sensitive ________ is to the abnormal genefunction.?arrow_forwardUsing the skills you learnt in the DNA Analysis tutorial, correctly identify the gene and species of the following DNA sequence: TATGCCCTGGTTATCTTCGAGATGGTCCACCTGAAGGAGCTGGGGCTTTATAACCTCATG Gene: Insulin Receptor (INSR), Species: Mus Musculus Gene: Insulin Receptor (INS), Species: Homo Sapiens Gene: Epidermal Growth Factor Receptor (EGFR), Species: Homo Sapiens Gene: Epidermal Growth Factor Receptor (EGFR), Species: Mus Musculusarrow_forwardw1 create make a creative hand-made poster of DNAreplication and central dogma of molecular biology (transcription and translation).arrow_forward
- b• What impact has the Human Genome Project had on medicine and health? On forensic DNA testing?arrow_forwardExplain the role of mRNA, tRNA, and rRNA in geneexpression.arrow_forward• Deletions remove _______________from a chromosome and causemutant phenotypes mainly through effects on gene dosage.arrow_forward
- Describe how different types of chromosomalrearrangements alter gene expression patterns orgenerate new gene productsarrow_forwardUsing the figure below identify: What is the role of histones and nucleosomes? How the process of chromatin condensation is performed? What is a function of introns and exons? What is a role of mobile DNA elements? What is a meaning of simple-sequence DNA?arrow_forwardGive 4 specific applications of Genetic Engineering and/or Genomics.arrow_forward
arrow_back_ios
SEE MORE QUESTIONS
arrow_forward_ios
Recommended textbooks for you
- Biology (MindTap Course List)BiologyISBN:9781337392938Author:Eldra Solomon, Charles Martin, Diana W. Martin, Linda R. BergPublisher:Cengage LearningBiology: The Dynamic Science (MindTap Course List)BiologyISBN:9781305389892Author:Peter J. Russell, Paul E. Hertz, Beverly McMillanPublisher:Cengage Learning
Biology (MindTap Course List)
Biology
ISBN:9781337392938
Author:Eldra Solomon, Charles Martin, Diana W. Martin, Linda R. Berg
Publisher:Cengage Learning
Biology: The Dynamic Science (MindTap Course List)
Biology
ISBN:9781305389892
Author:Peter J. Russell, Paul E. Hertz, Beverly McMillan
Publisher:Cengage Learning
Mitochondrial mutations; Author: Useful Genetics;https://www.youtube.com/watch?v=GvgXe-3RJeU;License: CC-BY