Campbell Biology
12th Edition
ISBN: 9780135188743
Author: Urry
Publisher: PEARSON
expand_more
expand_more
format_list_bulleted
Concept explainers
Textbook Question
thumb_up100%
Chapter 17, Problem 1TYU
In eukaryotic cells, transcription cannot begin until
(A) the two DNA strands have completely separated and exposed the promoter.
(B) several transcription factors have bound to the promoter.
(C) the 5' caps are removed from the mRNA.
(D) the DNA introns are removed from the template.
Expert Solution & Answer
Want to see the full answer?
Check out a sample textbook solutionStudents have asked these similar questions
In the diagram of transcription shown here, fill in the blanks with the appropriate terms: (a) gene; (b) promoter; (c) terminator; (d) RNA polymerase; (e) mRNA.
A single template strand of a DNA molecule is represented by
3’atgtaccatgcgcaaatttaaaggccc5’.
a) Using the same strand above as a template, write the pre-mRNA transcript.
b) List the molecules that must be present for DNA to be transcribed. Briefly describe their function.
c) What are three modifications that happen to pre-mRNA before it becomes mature mRNA
A single template strand of a DNA molecule is represented by
3’atgtaccatgcgcaaatttaaaggccc5’.
a) Imagine that AAG is an INTRON in the original DNA template strand above. Write the mature mRNA strand after the three modifications?
b) Write the amino acid sequence of your mature mRNA.
c) List the molecules involved in translation and briefly describe their function.
Chapter 17 Solutions
Campbell Biology
Ch. 17.1 - Prob. 1CCCh. 17.1 - What polypeptide product would you expect from a...Ch. 17.1 - Prob. 3CCCh. 17.2 - MAKE CONNECTIONS In a research artide about...Ch. 17.2 - What enables RNA polymerase to start transcribing...Ch. 17.2 - WHAT IF? Suppose X-rays caused a sequence change...Ch. 17.3 - There are about 20,000 human protein-coding genes....Ch. 17.3 - How is RNA splicing similar to how you would watch...Ch. 17.3 - Prob. 3CCCh. 17.4 - What two processes ensure that the correct amino...
Ch. 17.4 - Prob. 2CCCh. 17.4 - Prob. 3CCCh. 17.4 - WH AT IF? In eukaryotic cells, mRNAs have been...Ch. 17.5 - What happens when one nucleotide pair is lost from...Ch. 17.5 - MAKE CONNECTIONS Individuals heterozygous for the...Ch. 17.5 - WHAT IF? DRAW IT The template strand of a gene...Ch. 17.5 - Prob. 4CCCh. 17 - Describe the process of gene expression, by which...Ch. 17 - What are the similarities and differences in the...Ch. 17 - What function do the 5' cap and the poly-A tail...Ch. 17 - Prob. 17.4CRCh. 17 - What will be the results of chemically modifying...Ch. 17 - In eukaryotic cells, transcription cannot begin...Ch. 17 - Prob. 2TYUCh. 17 - The anticodon of a particular tRNA molecule is (A)...Ch. 17 - Prob. 4TYUCh. 17 - Which component is not directly involved in...Ch. 17 - Using Figure 17.6, identify a 5' 3' sequence of...Ch. 17 - Prob. 7TYUCh. 17 - Would the coupling of the processes shown in...Ch. 17 - Prob. 9TYUCh. 17 - Prob. 10TYUCh. 17 - scientific inquiry Knowing that the genetic code...Ch. 17 - Prob. 12TYUCh. 17 - Prob. 13TYU
Additional Science Textbook Solutions
Find more solutions based on key concepts
Why is it necessary to be in a pressurized cabin when flying at 30,000 feet?
Anatomy & Physiology (6th Edition)
2. A gene is a segment of DNA that has the information to produce a functional product. The functional product ...
Genetics: Analysis and Principles
2. A gene is a segment of DNA that has the information to produce a functional product. The functional product ...
Genetics: Analysis and Principles
Why are mutants used as test organisms in the Ames test?
Laboratory Experiments in Microbiology (11th Edition)
How does trandlation differ from transcription?
Microbiology: Principles and Explorations
2. Define equilibrium population. Outline the conditions that must be met for a population to stay in genetic e...
Biology: Life on Earth (11th Edition)
Knowledge Booster
Learn more about
Need a deep-dive on the concept behind this application? Look no further. Learn more about this topic, biology and related others by exploring similar questions and additional content below.Similar questions
- RNA polymerases generally require a primer to begin transcription. (T) (F) The Death Cap Mushroom Amanita phalloides is toxic because of its ability to produce alpha-amanitin, which is an inhibitor of RNA Polymerases I and III. (T) (F) In bacteria, transcription and translation can occur simultaneously. (T) (F) In eukaryotes, transcription and translation can occur simultaneously (T) (F) RNA polymerase II has no form of proofreading activity. (T) (F) Sigma factors specify binding of bacterial RNA Polymerases to specific promoters (T) (F) An E. coli strain with mutations in genes encoding both the dam methylase and the RecA protein would likely be inviable (dead) (T) (F) An E. coli culture grown in a pure (100%) N2 atmosphere would likely have a lower rate of mutations than a culture grown under normal conditions (~30% O2 and 70% N2) (T) (F) Non-homologous end joining repairs double strand DNA breaks with no loss of information, restoring the original…arrow_forwardWhich statement is false: A) Each type of protein ( ex: hemoglobin vs trypsionngen) varies in the length and amino acid sequence of its peptide B) After the rpocess of transcription is complete, the mRNA that is produced will continue being tranlsated by ribosomes for the rest of the cells life. mRNA never breaks down C) A ribosome will bind to an mRNA and will translate the sequence by reading one codon at a time and adding one amino acid to the peptide chain. It will stop the translation once it encounters a stop codon D) The gene for a protein provides the information on the legth of the peptide, along w the amino acid sequence so the protein can be synthesized by a ribosome E) Once mRNA has left the nucleus, ribosomes will bind to it and will follow the instructions in its sequence to make the new protienarrow_forwardTranscription and translation are separate processes in gene expression; however, they have similarities. The following terms all relate to translation. Which of these has a role that is most similar to that of the transcription start site during transcription? A)Start codon B)Stop codon C)tRNA D)Amino acidarrow_forward
- Below is a template strand of DNA. Assume the transcription start site is outside of this sequence so that the whole sequence is transcribed. After the mRNA is made, what amino acid sequence would be translated from this sequence? Translation begins at the first start codon of the mRNA. DNA template strand: 5’ ...ACTGATGCCCATGGC... 3’ a)Met-Pro-Met b)Ala-Met-Gly-Ile-Ser c)Thr-Asp-Ala-His-Gly d)Met-Gly-Ile-Serarrow_forwardUsing the transcription unit diagrammed below, in which exons are represented by blue boxes and introns are represented by the connecting lines. You discover a single base deletion in region E of this DNA sequence. Regarding transcription, this mutation will likely: 1.) Result in an alteration to the mRNA sequence. 2.)Have no effect on transcription or the mRNA sequence 3.)Prevent transcription at the TATAA box 4.) Result in an increase or decrease in the amount of mRNA transcribedarrow_forwardA regulatory region shows all of the following properties except a) can be located in an exon. b) can be located at a distance from the gene. c) acts as a binding site for transcription factors. d) acts as a binding site for a polymerase.arrow_forward
- A TATA box (core promoter) is ____________.Group of answer choices a) None of the above b) binding site for RNA polymerase II and essential to initiate transcription c) one of the stop codons d) the translation termination sequence.arrow_forwardWhich of the following regulatory sequence allows transcription to continue? a) Sequence 4 b) Sequence 1 c) Sequence 2 d) Sequence 3arrow_forwardWhat is a response element? O A) A short stretch of DNA sequence implicated in the initiation of translation O B) A short stretch of DNA sequence essential for RNA splicing O C) A short stretch of DNA sequence found within the basal and regulatory promoter regions of genes D) A special protein implicated in the initiation of transcriptionarrow_forward
- Hydrogen bonds are important in DNA replication and transcription. They are relatively weak chemical bonds. Why is this a desirable feature for DNA? Describe the effect (s) of changing (mutating) the promoter on the transcription of the DNA strand/gene the promoter controls. What happens to protein synthesis if a nonsense codon is inserted into the gene? Explain why a point mutation does not necessarily change the original amino acid sequence. (Explain silent mutations) Choose any pentapeptide composed of five different amino acids. List the amino acids. Present one messenger RNA codon for each amino acids and the sequence of nucleotides on the DNA that originally coded for your pentapeptide.arrow_forwardWhich of the following is/are a role for the poly-A tail? (Select all that apply.) a) Facilitates transport of the transcript out of the nucleus b) Confers stability to the mRNA c) Binds to RNA polymerase to initiate transcription d) Facilitates binding to DNAarrow_forwardWhich of these molecules would have the most monomers (i.e. be longest)? a) RNA polymer that comprises the transfer RNA b) mRNA transcript just after transcription c) polypeptide chain released by ribosome d) mRNA transcript that a ribosome attaches toarrow_forward
arrow_back_ios
SEE MORE QUESTIONS
arrow_forward_ios
Recommended textbooks for you
- Human Anatomy & Physiology (11th Edition)BiologyISBN:9780134580999Author:Elaine N. Marieb, Katja N. HoehnPublisher:PEARSONBiology 2eBiologyISBN:9781947172517Author:Matthew Douglas, Jung Choi, Mary Ann ClarkPublisher:OpenStaxAnatomy & PhysiologyBiologyISBN:9781259398629Author:McKinley, Michael P., O'loughlin, Valerie Dean, Bidle, Theresa StouterPublisher:Mcgraw Hill Education,
- Molecular Biology of the Cell (Sixth Edition)BiologyISBN:9780815344322Author:Bruce Alberts, Alexander D. Johnson, Julian Lewis, David Morgan, Martin Raff, Keith Roberts, Peter WalterPublisher:W. W. Norton & CompanyLaboratory Manual For Human Anatomy & PhysiologyBiologyISBN:9781260159363Author:Martin, Terry R., Prentice-craver, CynthiaPublisher:McGraw-Hill Publishing Co.Inquiry Into Life (16th Edition)BiologyISBN:9781260231700Author:Sylvia S. Mader, Michael WindelspechtPublisher:McGraw Hill Education
Human Anatomy & Physiology (11th Edition)
Biology
ISBN:9780134580999
Author:Elaine N. Marieb, Katja N. Hoehn
Publisher:PEARSON
Biology 2e
Biology
ISBN:9781947172517
Author:Matthew Douglas, Jung Choi, Mary Ann Clark
Publisher:OpenStax
Anatomy & Physiology
Biology
ISBN:9781259398629
Author:McKinley, Michael P., O'loughlin, Valerie Dean, Bidle, Theresa Stouter
Publisher:Mcgraw Hill Education,
Molecular Biology of the Cell (Sixth Edition)
Biology
ISBN:9780815344322
Author:Bruce Alberts, Alexander D. Johnson, Julian Lewis, David Morgan, Martin Raff, Keith Roberts, Peter Walter
Publisher:W. W. Norton & Company
Laboratory Manual For Human Anatomy & Physiology
Biology
ISBN:9781260159363
Author:Martin, Terry R., Prentice-craver, Cynthia
Publisher:McGraw-Hill Publishing Co.
Inquiry Into Life (16th Edition)
Biology
ISBN:9781260231700
Author:Sylvia S. Mader, Michael Windelspecht
Publisher:McGraw Hill Education
QCE Biology: Introduction to Gene Expression; Author: Atomi;https://www.youtube.com/watch?v=a7hydUtCIJk;License: Standard YouTube License, CC-BY