Human Heredity: Principles and Issues (MindTap Course List)
11th Edition
ISBN: 9781305251052
Author: Michael Cummings
Publisher: Cengage Learning
expand_more
expand_more
format_list_bulleted
Concept explainers
Textbook Question
Chapter 9, Problem 4QP
If the genetic code uses triplets, how many different amino acids can be coded by a repeating RNA
- a. one
- b. two
- c. three
- d. four
- e. five
Expert Solution & Answer
Trending nowThis is a popular solution!
Students have asked these similar questions
Which of the following statements below is incorrect? *
A. the genetic code is overlapping
B. the genetic code is universal
C. degenerate codon specify the same amino acids
D. the genetic code is triplet
Which protein can break covalent bond? *
A. Helicase
B. Primase
C. SSB
D. DNA gyrase
What is the complementary hnRNA base sequence produced from the DNA base sequence 5' C-T-A-T-A-C 3'? *
A. 3' C-A-T-A-T-C 5'
B. 3' G-A-T-A-T-G 5'
C. 3' G-A-U-A- U-G 5'
D. 3' C-U-A-U-A-G 5'
Which of the following statements concerning the " cloverleaf" shape of tRNA molecules is correct? *
A. four hairpin loops are present
B. three hairpin loops and one open end are present
C. two hairpin loops and two open ends are present…
Given is the 30 nucleotides in the human gene for hemoglobin (the oxygen-carrying protein in the red blood cells): 5’ TAC-CAC-GTG-GAC-TGA-GGA-CTC-CTC-TTC-AGA 3’
a. What is the complementary strand?
b.Deduce the mRNA in this coding region.
c.What is the amino acid sequence based on this mRNA?
d. A very important mutation in human hemoglobin occurs in this DNA sequence, where the T at nucleotide 20 is replace with an A. The mutant hemoglobin is called sickle cell hemoglobin and is associated with severe anemia. What is the amino acid replacement that results in sickle-cell hemoglobin?
Given is the 30 nucleotides in the human gene for hemoglobin (the oxygen-carrying protein in the red blood cells): 5’ TAC-CAC-GTG-GAC-TGA-GGA-CTC-CTC-TTC-AGA 3’a. What is the complementary strand?b. Deduce the mRNA in this coding region.c. What is the amino acid sequence based on this mRNA?d. A very important mutation in human hemoglobin occurs in this DNA sequence, where the T at nucleotide 20 is replace with an A. The mutant hemoglobin is called sickle cell hemoglobin and is associated with severe anemia. What is the amino acid replacement that results in sickle-cell hemoglobin?
Chapter 9 Solutions
Human Heredity: Principles and Issues (MindTap Course List)
Ch. 9.6 - Antibiotics and Protein Synthesis Antibiotics are...Ch. 9.6 - Antibiotics and Protein Synthesis Antibiotics are...Ch. 9 - There have been recurring cases of mad-cow disease...Ch. 9 - There have been recurring cases of mad-cow disease...Ch. 9 - There have been recurring cases of mad-cow disease...Ch. 9 - The Link Between Genes and proteins The genetic...Ch. 9 - Define replication, transcription, and...Ch. 9 - If the genetic code used 4 bases at a time, how...Ch. 9 - If the genetic code uses triplets, how many...Ch. 9 - What is the start codon? What are the stop codons?...
Ch. 9 - Is an entire chromosome made into an mRNA during...Ch. 9 - The promoter and terminator regions of genes are...Ch. 9 - The following segment of DNA codes for a protein....Ch. 9 - What are the three modifications made to pre-mRNA...Ch. 9 - The pre-mRNA transcript and protein made by...Ch. 9 - Briefly describe the function of the following in...Ch. 9 - Prob. 12QPCh. 9 - Determine the percent of the following gene that...Ch. 9 - How many kilobases of the DNA strand below will...Ch. 9 - Prob. 15QPCh. 9 - Given the following tRNA anticodon sequence,...Ch. 9 - Given the following mRNA, write the...Ch. 9 - The following is a portion of a protein:...Ch. 9 - Below is the structure of glycine. Draw a...Ch. 9 - Indicate in which category, transcription or...Ch. 9 - Prob. 21QPCh. 9 - Polypeptide folding is often mediated by other...Ch. 9 - Do mutations in DNA alter proteins all the time?Ch. 9 - a. Can a mutation change a proteins tertiary...
Knowledge Booster
Learn more about
Need a deep-dive on the concept behind this application? Look no further. Learn more about this topic, biology and related others by exploring similar questions and additional content below.Similar questions
- The addition of the poly-A tail adds more than 200 units of adenine to the strand of mRNA, yet no protein has a continuous line of more than 200 phenylalanines in its structure. Why is this so? A. RNA splicing occurs and removes the noncoding sequences. B. The poly-A tail and 5' GTP cap do not translate into proteins. C. The adenines are reabsorbed by the cell and help to form other forms of RNA. D. The tRNA does not recognize the poly-A tail.arrow_forwardThe genetic code is based on four different bases with the structures shown here. Determine the hybridization in each interior atom in these four bases. a. cytosine b. adenine c. thymine d. guanine NH2 H HC SCH HC H NH2 a. b. H HC HN1 8CH NH H;C H2N H d.arrow_forwardWhy might a single base-pair mutation in eukaryotic mRNA be less serious than one in prokaryotic mRNA? a. If the mutation occurs in the 5' end of the start site, it will not affect the gene product. b. If the mutation occurs in the exon, it will not affect the gene product. c. If the mutation occurs in the splice site of a transcript with alternative splicing, only one gene product may affected. O d. If the mutation occurs in the intron or not in the splice site of a transcript with alternative splicing, it will nc affect the gene product. O e. If the mutation occurs in the 3' end of the start site, it will not affect the gene product. OLIE STIC N 1Aarrow_forward
- Given the following DNA sequence: ATCGGATCCGGTTAACTATTTAAAGCA a. predict the compliment strand of dna (coding strand) b. predict the transcribed product of the coding strand (mRNA transcript) c. given the genetic code table, predict the amino acid sequence of the transcript d. predict the amino acid sequence if the A underlined became deletedarrow_forwardThe AUC and AUA codons in mRNA both specify isoleucine. What feature of the genetic code explains this? a. complementarity b. nonsense codons c. universality d. degeneracyarrow_forwardFor each example: a. fill in the complimentary DNA strand b. fill in the correct mRNA bases by transcribing the bottom DNA code c. fill in the correct tRNA bases d. translate the MRNA codons to find the correct amino acids Example #1 5' 3' (A (A DNA MRNA TRNA Amino Acidsarrow_forward
- In any given species, there are at least how many types of aminoacyl tRNA synthetases? a. 20 b. 40 c. 100 d. 200arrow_forwardtRNAs a. carry amino acids b. bind to the anticodon present in the mRNA c. adapt the genetic information to the ribosome d. catalyze the peptide bondarrow_forwardThe degeneracy of the Genetic code is due to A. a 1 to 1 correlation between single amino acids and single nucleotides B. The fact that tRNAs can bind to mRNAs at the same time they transfer amino acids to a growing polypeptide chain C. The fact that there is only one start codon D. The fact that the code is non-overlapping E. The fact that more than one codon specifying an amino acid F. None of the abovearrow_forward
- Which of the following are elongation factors involved in the release of free tRNAs? a.EF-G b.EF-Ts c.EF-Tu d.EF-Parrow_forwarda molecular geneticist hopes to find a gene in human liver cells that codes for an important blood-clotting protein. he knows that the nucleotide sequence of a small part of the gene is gtggactgaca. briefly explain how to obtain the desired gene answerarrow_forwardWhich of the following is the mRNA coding for the peptide trp-met-gly- ser-his? A. 5'GGUGUAUGGUCUUAC-3' B. 5'-CAUUCUGGUAUGUGG-3' C. 5'-UGGAUGGGUUCUCAU-3' D. 3'-UGGAUGGGUUCUCAU-5' E. cannot be determined since the genetic code is degeneratearrow_forward
arrow_back_ios
SEE MORE QUESTIONS
arrow_forward_ios
Recommended textbooks for you
- Human Anatomy & Physiology (11th Edition)BiologyISBN:9780134580999Author:Elaine N. Marieb, Katja N. HoehnPublisher:PEARSONBiology 2eBiologyISBN:9781947172517Author:Matthew Douglas, Jung Choi, Mary Ann ClarkPublisher:OpenStaxAnatomy & PhysiologyBiologyISBN:9781259398629Author:McKinley, Michael P., O'loughlin, Valerie Dean, Bidle, Theresa StouterPublisher:Mcgraw Hill Education,
- Molecular Biology of the Cell (Sixth Edition)BiologyISBN:9780815344322Author:Bruce Alberts, Alexander D. Johnson, Julian Lewis, David Morgan, Martin Raff, Keith Roberts, Peter WalterPublisher:W. W. Norton & CompanyLaboratory Manual For Human Anatomy & PhysiologyBiologyISBN:9781260159363Author:Martin, Terry R., Prentice-craver, CynthiaPublisher:McGraw-Hill Publishing Co.Inquiry Into Life (16th Edition)BiologyISBN:9781260231700Author:Sylvia S. Mader, Michael WindelspechtPublisher:McGraw Hill Education
Human Anatomy & Physiology (11th Edition)
Biology
ISBN:9780134580999
Author:Elaine N. Marieb, Katja N. Hoehn
Publisher:PEARSON
Biology 2e
Biology
ISBN:9781947172517
Author:Matthew Douglas, Jung Choi, Mary Ann Clark
Publisher:OpenStax
Anatomy & Physiology
Biology
ISBN:9781259398629
Author:McKinley, Michael P., O'loughlin, Valerie Dean, Bidle, Theresa Stouter
Publisher:Mcgraw Hill Education,
Molecular Biology of the Cell (Sixth Edition)
Biology
ISBN:9780815344322
Author:Bruce Alberts, Alexander D. Johnson, Julian Lewis, David Morgan, Martin Raff, Keith Roberts, Peter Walter
Publisher:W. W. Norton & Company
Laboratory Manual For Human Anatomy & Physiology
Biology
ISBN:9781260159363
Author:Martin, Terry R., Prentice-craver, Cynthia
Publisher:McGraw-Hill Publishing Co.
Inquiry Into Life (16th Edition)
Biology
ISBN:9781260231700
Author:Sylvia S. Mader, Michael Windelspecht
Publisher:McGraw Hill Education
Biomolecules - Protein - Amino acids; Author: Tutorials Point (India) Ltd.;https://www.youtube.com/watch?v=ySNVPDHJ0ek;License: Standard YouTube License, CC-BY