12. What is the major organic product obtained from the following reaction? OCH 3 Br2 CH3CO₂H Br 1 2 OCH3 3 OCH 3 4 OCH3 Br Br CH3 CH3 CH₂Br CH3 CH3
Q: R 20 O- protein N CH3 H₂N asparagine side chain HO OH OH activated sugar Draw the product of the…
A: An O-glycosidic bond is a covalent bond formed between a carbohydrate's anomeric carbon and the…
Q: 3. Acetylcholinesterase is a serine hydrolase enzyme im- portant in nerve signal transmission,…
A: Approach to solving the question: Enzyme reactions. Detailed explanation:1. here's an arrow-pushing…
Q: Camels survive in the desert because they derive water from the large deposit of triglycerides…
A: We are considering the breakdown of the triglyceride, tripalmitoylglycerol. Tripalmitoylglycerol is…
Q: (a) In the space below draw a free energy landscape diagram for the conversion of substrate (S) into…
A: Transition state theory states that as a substrate is converted into a product, a high energy state…
Q: In a tabular form list two differences between heat shock and electroporation as methods of…
A: Transformation is the process by which a cell takes in naked DNA from its environment. Heak shock…
Q: Sketch out the binding site of Hemoglobin with oxygen bound . ( You can abstract the Heme ring out…
A: Hemoglobin is a metalloprotein that contains iron. Hemoglobin is present in the red blood corpuscles…
Q: what is The standard free energy change for the combined system that you wrote in the previous…
A: The standard free energy change (∆G°) of a chemical reaction is the free energy change at the…
Q: In the salvage of purines, hypoxanthine-guanine phosphoribosyltransferase (HGPRT) is responsible for…
A: Purines are heterocyclic rings made up of a five-membered ring fused to a six-membered ring.…
Q: why do so many pharmaceutical drugs contain nitrogen? How would an NH2 group benefit this dimer…
A: The objective of the question is to find the reason why so many pharmaceutical drugs contain…
Q: 12. What value do O-linked saccharides serve for membrane surface proteins? Which amino acid…
A: O-linked saccharides, also known as O-linked glycans, are carbohydrates that are attached to…
Q: B-oxidation deals with only saturated fatty acids, but many fatty acids in natural lipids are…
A: Beta oxidation is a metabolic process in which the two carbon atoms are sequentially removed from…
Q: Fill in the RNA quantification table below: Sample A260 A280 A260 A280 Concentration (ng/μl)…
A: The conversion factor depends on the type of RNA being quantified.Conversion factors for different…
Q: Certain bacteria can respire in anoxic environments using arsenic (V) as electron acceptor. The…
A: “Since you have posted a question with multiple sub-parts, we will provide the solution only to the…
Q: You will have to dilute your inital Lysozyme stock in order to pipet volumes larger than 10 uL for…
A: Step 1:For the Bradford assay, the typical concentration range of protein you want to target is…
Q: Identify the product of the given reaction. IV I II III heat ? = III IV
A: Option (d) III is correct See solution in image Explanation:
Q: 111: 900 Page 3 (b) Construct an energy-level diagram of 2-pentene showing the relative energy…
A: Already done Explanation:Step 1: Step 2: Step 3: Step 4:
Q: The conversion of pyruvate into acetyl CoA consists of three steps. Identify these three steps and…
A: The pyruvate dehydrogenase complex (PDHC) is an enzyme complex composed of 3 enzymes.Pyruvate…
Q: The kinetic data in the following table were obtained for the reaction of carbon dioxide and water…
A: The substrate affinity of CO2 for carbonic anhydrase or Km is found to be 10 mM.Explanation:Step 1:…
Q: 1. Opine dehydrogenases (ODH) have evolved in invertebrate marine organisms with wide-ranging…
A: To determine the L/D configuration of amino acids, place the alpha carbon () in the center, the…
Q: Carbamazepine is a lipid -soluble antiepileptic drug that has a larger volume of distribution in…
A: The objective of the question is to understand the effect of obesity on the elimination half-life of…
Q: p53 is an activator of a miRNA called miR-145. miR-145 targets c-myc, a gene that promotes cellular…
A: Increased proliferation and survival.Explanation:Increased proliferation and survival would be the…
Q: None
A: The statement in question relates to the process of decarboxylation in the tricarboxylic acid (TCA)…
Q: With the ninhydrin method, it was determined that an acyclic decapeptide consists of the following…
A: Elastase cleaves the peptide bonds formed by small hydrophobic amino acids, towards the C-terminal…
Q: Biochemistry...Represent the reactions when Phosphatidylethanolamine was treated with; (I)…
A: Phosphatidylethanolamine (PE) is a type of phospholipid found in cell membranes. It consists of a…
Q: Studying mis-splicing events on a cell-wide basis (i.e., all mis-splicing events in a cell type) can…
A: Studying mis-splicing events on a cell-wide basis (i.e., all mis-splicing events in a cell type) can…
Q: 2. What is the major organic product obtained from the following reaction? CH3 Brz FeBr3 CH₂Br CH3…
A: Step 1:
Q: Ringlemann scale is used to analyze O a. Carbon monoxide Ob. Nitrogen dioxide O c. hydrocarbons O d.…
A: The objective of the question is to identify the substance that the Ringlemann scale is used to…
Q: 16. A quantitative study of the interaction of a protein with its ligand yielded the following…
A: I cannot plot the graph as that would be doing your homework.Determine KD:From the graph, read the…
Q: Consider the reaction below to answer the following question(s). A B C NO₂ FeBrz + B12 D Fill in the…
A:
Q: What is the concentration in ppm of Sulphur in a water supply if there are 0.002mL of Sulphur in…
A: Step 1:We need to use the conversion 1ppm= 0.001mL/LBased on the given,Since we have 0.002mL/L…
Q: Which of the following has the compounds shown in the correct order of decreasing acidity (i.e.,…
A: Step 1: • Let's understand step by step: 1) Acidic Behavior: A compound is considered acidic if it…
Q: Biological Macromolecules Identifying molecules that could be in a cell membrane te for advanced…
A: Cell membranes are mostly composed of phospholipids. An important characteristic of phospholipids is…
Q: 9. A) Please write down the names of the following protein folds. A B C B) Which one(s) is made of…
A: C) Haemoglobin the motif is coiled structure which facilitates binding of four polypeptide chains,…
Q: What percentage of max is obtained when the substrate is present at 80% of the Km? Use two digits in…
A: is the maximum velocity attained by an enzyme during a reaction. is the substrate concentration at…
Q: using sample prep aka the protocol use it to fill in the tables
A: Explanation: Lysozyme (mL): The amount of lysozyme diluted and added to each conical tube. The…
Q: What is the final reaction in the final round of fatty acid synthase? Acetyl-CoA ACP Transacylase…
A: The question is asking about the final reaction in the process of fatty acid synthesis. Fatty acid…
Q: Derive an Equation that explains the realtionship between kE and kN with respect to the equilibrium…
A: Equation: This reaction is governed by the equilibrium constant , where: - (1)Assuming that…
Q: 1. What is the isoelectric point of tyrosine? Draw out the different structures of tyrosine at each…
A: **Since you have posted multiple questions, we will provide the solution only to the first question…
Q: The following diagram show what is required for an active promoter of a gene of interest, where:A1 =…
A: Based on the given diagram, here are the predictions:Chromatin conformation: EuchromatinMethylation…
Q: A coal fire plant uses 1 kg of coal to generate 1000 kWh of electricity and emits 50 kg of CO2 and 5…
A: The objective of the question is to understand the relationship between the functional unit (FU) and…
Q: 2. The precise biochemical mechanisms underlying the rapid shutdown of glycolysis in skeletal muscle…
A: (a) Approach to solving the question: The main process by which glucose is broken down to produce…
Q: Reaction rate 0.35 0.30 0.25 0.20 0.15- 0.10 0.05 0.00 0 1000 2000 Enzyme total is 5mM 3000 4000 1.…
A: MM graph is constructed by taking substrate and reaction velocity on X and Y axes respectively. The…
Q: 7. What is the driving force that promotes secondary structure formation of alpha helices and beta…
A: Two types of secondary structures are abundant in protein: alpha helix and beta sheets.The alpha…
Q: 8) Consider the tetrasaccharide stachyose drawn below. Stachyose is found in white jasmine,…
A: Stachyose is a tetrasaccharide consisting of two D-galactose units, one D-glucose unit, and one…
Q: Draw the major organic product of the following reaction. conc. KMnO4, heat
A: Answer is given below Explanation:
Q: Please help me fill in all the information
A: 1. **Conversion of Pyruvate to Acetyl-CoA**: - **Pyruvate Dehydrogenase Complex**: This complex of…
Q: MATCH a structure or term from the following list with each description below. Place the letter of…
A: 1. The reactive electrophile in Friedel-Crafts acylation reactions (R3C⁺): In Friedel-Crafts…
Q: Draw the structure of the isoprenoid biogenic precursor of the terpenes and show the steps in the…
A: Terpenes are unsaturated hydrocarbons produced by conifers (plants). Their general chemical formula…
Q: 3'- AATAAAAAAGGTCCCAAAAAATTAGGGGAGACGGTACATAAA GAGTAGAGTCATAAATTTTAGAGATGCGTA - 5' Table 22.4 mRNA…
A: The process of protein synthesis is also known as translation. The process of translation is…
Q: -22 2. (10 pts) Overlapping part of wave function of C-O bond (from to + in x-axis) is expressed by:…
A: The detailed ans has been attached. Explanation:
Step by step
Solved in 2 steps with 1 images
- What is the major organic product obtained from the following reaction? 3 1 4 2 CH22 Zn(Cu) Et20 H3C H3C 1 2 IH2CWhat is the major organic product obtained from the following reaction? CH3 2 4 3 1 (CH3)2C=CH2 HF CH3 CH3 CH3 1 2 3Select the aldol condensation product of the following reaction. a A b B с C d D e E A H HO H NaOH, EtOH heat H H B D E
- Draw the major organic product for the following reaction. 1. LiAlH ཝ་རི་-w;"", - CH3-C C-CH 2.What is the major organic product obtained from the following reaction? NaOH, H,O Δ ཨི ཁ (O) 2 ས () 3 1 4 3 2What substitution product are you expecting from the reaction below? NaCl O O O OH CI xo OCH 3 xox This reaction is unlikely to do a substitution reaction. 00 €
- C Select the product of the following aldol condensation reaction. a A b B C [] d D e E A H H H B H KOH, EtOH heat OH с D E4c give the product if the reaction will occur, write no reaction if noneQuestion 54 Electron transport and chemiosmosis (is the movement of ions across a semipermeable membrane, down their electrochemical gradient.) occur during both aerobic cell respiration and photosynthesis. What is the purpose of electron transport and chemiosmosis in both cell respiration and photosynthesis? O To create sugar molecules from oxygen gas O To create water molecules from carbon dioxide gas OTo use the energy released from slowing electrons to build ATP OTo usc he energy released from slowing electrons to create light
- 1.What are the major products obtained from the following reactions? Indicate the geometry (cis/trans). a) HBr, CH,COOH H3CH2C-CEC-CH2CH3 ? b) H- -C4 H9 ? CH,Cl2 2 2. For each reaction, give the expected substitution product and predict whether the mechanism will be first order (Sy1) or second order (Sy2): a) 2-chloro-2-methylbutane + CH;COOH b) isobutyl bromide + NAQME, c) 1-iodo-1-methylcyclohexane + CH,CH;OHDraw the major organic product obtained form the following sequence of reactions (assume that mixtures of ortho and para disubstituted compounds can be separated; continue the synthesis with either one)? NO₂ Br, FeBr3 H2, Ni NaNO2, H3O+ HBF41. Rank the following amines from lowest to highest boiling point. Explain your reasoning. CH3 CH2CH3 H3C CH3 ༣.མིའི་ན་བྱིན་ CH NH₂ -CH3 H₂ NH2 2. Which compound in each pair would have the higher boiling point? Why? a. H3C CH3 H3C OH b. NH2 CH3 H₂ H3C CH CH CH3 H3C -CH3 NH2 3. Circle each of the following molecules that would be significantly soluble in water. Explain. ΝΗΣ H₂ H₂ H₂ H₂ CH C- NH₂ H3C -CH3 H3C H2 H₂ CH3 CH CH3 H3C -CH3 H3C H₂