Answered: 3)Consider the following sequence: 5'…

3)Consider the following sequence: 5' - AUGGCUACAGAUAGCUGGGGCUGAAAAAAAAAAAAAAA..3' Translated, the corresponding protein contains how many amino acids: a) 6 b) 7 c) 8 d) 13

Biochemistry

9th Edition

ISBN:9781319114671

Author:Lubert Stryer, Jeremy M. Berg, John L. Tymoczko, Gregory J. Gatto Jr.

Publisher:Lubert Stryer, Jeremy M. Berg, John L. Tymoczko, Gregory J. Gatto Jr.

Chapter1: Biochemistry: An Evolving Science

Section: Chapter Questions

Problem 1P

See similar textbooks

Related questions

Q: How many net molecules of ATP and NADH are produced in "anaerobic glycolysis" (glycolysis +…

A: Anaerobic glycolysis of fructose 1,6-bisphosphate involves 7 reactions of glycolysis followed by the…

Q: 1) When warfarin is prescribed with antibiotic sulfadiazine, what be the most possible interaction?…

A: Sulfadiazine is an antibacterial drug that treats urinary tract infections. Warfarin is an…

Q: Identify the amino acid (s) present in this structure. serine valine threonine tyrosine cysteine…

A: The molecule in question is a dipeptide i.e. 2 amino acids joined together via a peptide bond. In a…

Q: Sixty hours after aspirin ingestion, the patient’s blood pH has returned to normal (pH 7.4).…

A: Consider the reversible reaction shown below and it has an equilibrium. A ⇌ B All reactions strive…

Q: Does lipids utilize phosphorylation in their metabolism?

A: Phosphorylation is a common biochemical process in which a phosphate group is added to a molecule,…

Q: Consider the fatty acid arachidonic acid, which has the structure shown below. Which of the…

A: Arachidonic acid is a 20-carbon fatty acid. It has 4 double bonds in its structure in the cis…

Q: 2. The overall reaction for the activation of a fatty acid to fatty acyl-CoA, with concomitant…

A: Fatty acid cannot enter mitochondria. To enter mitochondria, it must be activated by adding a CoA to…

Q: The Re value is used to help identify substances that are separated by paper chroma- tography. It is…

A: Retention factor or Rf gives a relative value of how far an analyte has travelled in comparison to…

Q: How can heme be removed from the extracted DNA in Blood?

A: Heme is a molecule that contain iron. Numerous proteins, such as myoglobin and hemoglobin, depend on…

Q: Which of the following enzymes are inhibited by corticosteroids? a) Lipoxygenase only b) COX-1 only…

A: Corticosteroids are a class of steroid hormones that are involved in a variety of physiological…

Q: Choose the enzyme and cofactors involved in the reaction of 1,3-bisphosphoglycerate to…

A: Glycolysis is one of the important metabolic pathway that converts glucose into pyruvate and…

Q: You are given unlabeled vials containing samples of a carbohydrate, a lipid, and a protein. Design…

A: Reducing sugars are carbohydrates which when reacts swith Benedict's solution and heating for a few…

Q: Arrange the steps of breakdown of oleic acid (pictured below) in the correct order. 1 2 3 4 5…

A: Beta oxidation: The enzyme fatty acyl-CoA synthase (FACS) adds a CoA group to the fatty acid chain…

Q: 1. For each structure, circle the sugar unit and identify the nucleotide as a ribonucleotide or a…

A: DNA/RNA are nucleic acids, the molecules responsible for carrying genetic information from one…

Q: Enzyme specificity (list the different types of enzyme specificities)

A: In enzyme catalysed reaction, the enzyme lowers this activation energy, thereby speeding up the…

Q: Match the type of glycosidic linkage with the molecules shown. Chitin Lactose Amylopectin Amylose…

A: Carbohydrates are one of the three macronutrients (along with proteins and fats) that are essential…

Q: -fatty acid synthesis RNA -> DNA Necessary to make RNA nucleotide G3P F6P &

A: Glucose-6-phosphate is a sugar molecule that is an important intermediate in several metabolic…

Q: Which of the following components of the ubiqutin-proteasome pathway are ATPases? (i.e., which…

A: The ubiquitin proteasome pathway (UPP) is a critical pathway for protein degradation in eukaryotic…

Q: ESDS pring2 9. Which type of molecule is generally chiral? A. triglycerides B. glucose oso GIMEH €…

A: The triesters of fatty acids with glycerol are called triglycerides or triacylglycerols. Glucose is…

Q: Below is a representation of glutamic acid with three incomplete functional groups in dashed boxes…

A: Amino acids have both carboxylic acid group and a amino a group along with a side chain. Hence, at…

Q: 3. A mixture of proteins shown in the table below are dissolved in water and injected into a size…

A: Gel filtration chromatography is also known as size exclusion chromatography, where protein or…

Q: True or False: Propionyl-CoA is converted to succinyl-CoA. Succinyl-CoA is then converted to malate…

A: Beta oxidation if even-numbered fatty acids yield acetyl CoA combines with oxaloacetate to form…

Q: 14.10) DNA contains the "information" needed for life. This information enables cells to grow and…

A: The double helix structure of DNA is an essential feature that allows for the storage and…

Q: Why is there a difference between the stock solution concentration of chymotrypsin calculated from…

A: Chymotrypsin is a digestive enzyme that breaks down proteins in the small intestine. It is commonly…

Q: A steady stream of recent research has confirmed the role of which gene in the development of…

A: A person suffering from Schizophrenia sees hallucinations and delusions. Although the exact reason…

Q: Can you help me with this question? Compare and contrast “fat” (triglycerides) and fatty acids.

A: Both fat and fatty acids are classified as lipids. Lipids are a chemically diverse group of…

Q: The complete oxidation of glucose 6-phosphate derived from free glucose yields 30 molecules ATP,…

A: The additional ATP requirement for the glycogenolysis step in glycogen metabolism causes the…

Q: Compared to the other proteins in the rat kidney, what characteristics (quantity and charge) of the…

A: Formation of the peptide bond neutralises any charge due carboxyl/amino group, therefore the net…

Q: 31. Explain the important biochemical functions of methionine and cysteine.

A: Methionine and cysteine are two essential amino acids that play vital roles in various biochemical…

Q: The secondary structure of a charged, or activated, tRNA molecule is given. An mRNA molecule is…

A: A variant of tRNA known as activated tRNA (transfer RNA) has been chemically modified to bind an…

Q: Identify the following items as being properties of either glycerophospholipids,…

A: Phospholipids are a class of lipids that are major components of cell membranes. They consist of a…

Q: Which peptide contains amino acids with side chains such that the peptide would exhibit…

A: When 2 uncharged atoms comes close to each other, their electron clouds influence each other. This…

Q: Match each description to the appropriate signal transduction stage. Reception A phytochrome…

A: Biochemical signalling is how cells communicate with each other. The effector cell secretes a…

Q: An experiment was performed to determine the effects of an inhibitor on the breakdown of glycogen by…

A: In the enzyme assay conducted here, we are trying to figure out how the kinetics of the reaction is…

Q: 2) Which type of chemical reactions are the cytochrome P450 enzymes involved in? a. Oxidation b.…

A: Detoxification is a vital process that the body undergoes to eliminate harmful substances or…

Q: Identify the amino acid(s) present in this structure. isoleucine Ophenylalanine valine cysteine…

A: The molecule in question is a dipeptide i.e. 2 amino acids joined together via a peptide bond. In a…

Q: Show the approximate position of the indicated four amino acids following electrophoresis. Here you…

A: Proteins are large, complex molecules that are essential to the structure and function of cells,…

Q: Question: Role of the triacyl glycerol cycle. Summarize the cycle referring to Figure 19.9. What…

A: Triacylglycerol (TAG) or triacylglycerides or triglycerides or simple fat or fat refers to the fatty…

Q: 2. At the end of the light reaction phase, NADPH is reduced to form NADP+, which is a major…

A: The light reaction phase is the first stage of photosynthesis that occurs in the thylakoid membranes…

Q: 13.13) Write the names (using the three letter abbreviation method) of all of the tripeptides that…

A: Tripeptide is the macromolecule formed from three amino acids. Amino acids are joined by peptide…

Q: 1. Contains both a(1→4) and a(1→6) glycosidic linkages 2. Polymer chain is unbranched 3. Glucose…

A: Carbohydrates are molecules made up of carbon hydrogen and oxygen with hydrogen to oxygen ratio…

Q: Propose a plausible enzyme mechanism for triose kinase, the enzyme that catalyzes the conversion of…

A: Triose kinase, like other kinases, catalyses the transfer of phosphate group from ATP to acceptors…

Q: What functional group(s) is/are present in the R group of tyrosine? Check all that apply. alcohol…

A: Tyrosine is an amino acid that consists of a central carbon atom (alpha carbon) bonded to an amino…

Q: Can you explain why when the pH level was changed from 0 to 5, the ATP production was affected…

A: ATP synthesis can occur by 2 modes: Substrate level phosphorylation Oxidative phosphorylation…

Q: Please explain this diagram in a simple but thorough way

A: Glucose is needed by the cell to generate energy. When blood glucose level is high, insulin is…

Q: A student performed an invertase activity assay on samples from a purification. All reactions…

A: Beer Lamberts law relates absorbance with concentration of analyte. The Beer lamberts expression is…

Q: Explain about Deamination and transdeamination.

A: Amino acids are fundamental building blocks of proteins and play crucial roles in numerous…

Q: H -ОН H-OH H— CH₂OPO3²- CH₂ HO-LH H-OH H-OH ÖH2OPO32- 2-О3РО. со (D) 2-3РОН2 (A) 2-O3PO O_CO CH₂…

A: There are three Aromatic amino acids: Phe, Tyr and Trp. All of them are synthesized from common…

Q: 3. دیا Fill in the table defining the stages, purpose, and product of cellular respiration. ✓✓✓…

A: Cellular respiration is a collection of three metabolic pathways that generate ATP the energy…

Q: Hydrophobia. Why is water excluded from the active site of phosphorylase? Predict the effect of a…

A: Glycogen phosphorylase catalyzes the rate-limiting step in glycogenolysis in animals by releasing…

Question

3)Consider the following sequence: 5' - AUGGCUACAGAUAGCUGGGGCUGAAAAAAAAAAAAAAA..3'
Translated, the corresponding protein contains how many amino acids:

a) 6

b) 7

c) 8

d) 13

Expert Solution

This question has been solved!

Explore an expertly crafted, step-by-step solution for a thorough understanding of key concepts.

SEE SOLUTION Check out a sample Q&A here

Step 1: Protein sequence

VIEW

Step 2: Genetic code and abbreviations

VIEW

Solution

VIEW

Step by step

Solved in 3 steps

SEE SOLUTION Check out a sample Q&A here

Similar questions

6. Given: 3"--TACTTCAAACCGGGCCCGATT--5 a) Give the sequence of nucleotides in the mRNA. b) What is the sequence of amino acids in the protein coded by the MRNA? c) If the first G is substituted by A, what is the sequence of amino acids in the protein? d) What type of mutation is illustrated by (e)?
Consider the following in light of the concept of levels of structure (primary, secondary, tertiary, quaternary) as defined for proteins. (a) What level is shown by doublestranded DNA? (b) What level is shown by tRNA? (c) What level is shown by mRNA?
Q) a) A protein gains a mutation of a surface exposed residue. The mutation is Arg --> Leu. Based on the sequence of the protein when it folds the Leu remains on the surface of the protein. What is the change in chemical characteristic of the amino acid caused by this mutation? b) Briefly explain any entropic consequences of this mutation. (2 sentences MAX) c) What might happen in order to overcome these entropic consequences and how would that affect the cell? (1-2 sentences)
30 A DNA sequence encoding a five-amino acid polypeptide is given below. …ACGGCAAGATCCCACCCTAATCAGACCGTACCATTCACCTCCT… …TGCCGTTCTAGGGTGGGATTAGTCTGGCATGGTAAGTGGAGGA… d) Assuming the sequence above is a bacterial gene, identify the region encoding the Shine-Dalgarno sequence. e) What is the function of the shine Dalgarno sequence?
An intermediate folding stage seen in protein denaturation or renaturation is called : a) domain b) motif c) subunit d) molten globule Proteins which do not renature spontaneously when denaturation conditions are removed may need the assistance of: a) a prosthetic group b) a higher salt concentration c) a lower temperature d) a chaperone protein The information needed for correct protein folding is encoded in: a) the surrounding molecules b) the protein’s amino acid sequence c) the pH of the aqueous medium d) the electrolyte composition of the aqueous solution
Answer D E and F d) in base pairing, why do we never see AG, GA, CT or TC forming complementary base pairs? e) why is vegetarianism a more energy intensive process (from the organism standpoint) than being omnivores? [DON'T EVEN THINK OF STATING ANYTHING ABOUT FIBER, BULK, AND/OR CELULOSE!!!!] f) why is significant serum (in the bloodstream) cholesterol reduction so difficult, and why do most of the drugs designed to reduce cholesterol target the liver?
(a) How is ubiquitination attached to the protein of interest? At which amino acid residue(s)? What enzyme(s) is involved, if any?(b) Is the ubiquitination relatively stable or highly dynamic? how does ubiquitination become detached from the protein of interest? what enzyme is involved?(c) what is the function of ubiquitination
Consider the following in light of the concept of levels of structure (primary, secondary, tertiary, quaternary)as defined for proteins.(a) What level is shown by double-stranded DNA?(b) What level is shown by tRNA?(c) What level is shown by mRNA?
Given the following DNA, (A) what is the transcript (MRNA) sequence? (B) What might be the amino acid sequence of the translated protein? 5'– ATGGCGAGGCGGCAGCTGTTATGGTGA – 3'
Suppose you have a cell-lysis sample containing genomic DNA, a complex mixture of proteins, and debris. Describe different commonly used analytical methods to i) analyze the molecular masses of the protein mixture. ii) detect the composition (what specific amino acids are there in what proportion) of a specific protein from the mixture. iii) deduce the sequence of some particular proteins from the mixture content
The following are sequences from three different alpha helices found inhuman proteins: hBak(72-87): GQVGRQLAIIGDDINR hCB1(196-210): VTASFTASVGSLFLT hCB2(248-262): LVLAVLLICWFPVL Classify each of these three helices as either a) mostly hydrophobic, b)mostly hydrophilic, or c) amphipathic. Use the helical wheel to explainyour answers. Given the character of these helices, in which part of the protein wouldyou expect them to reside?
A) Based on the mRNA sequence below, provide the corresponding DNA template (5'-3') and protein sequences (N-C terminus) using the single letter abbreviations for each 5' GCA UAU CCU UGU GAU 3' B) Identify the two unique amino acids in the protein sequence above, provide their full names and brief explanation why you chose them C) Draw the two amino acids from 3. connected with a peptide bond to each other (with free amino and carboxy termini) at physiological pH|