Concepts of Genetics (12th Edition)
12th Edition
ISBN: 9780134604718
Author: William S. Klug, Michael R. Cummings, Charlotte A. Spencer, Michael A. Palladino, Darrell Killian
Publisher: PEARSON
expand_more
expand_more
format_list_bulleted
Concept explainers
Textbook Question
thumb_up100%
Chapter 12, Problem 11PDQ
Provide a comprehensive definition of heterochromatin and list as many examples as you can.
Expert Solution & Answer
Want to see the full answer?
Check out a sample textbook solutionStudents have asked these similar questions
Compare heterochromatin and euchromatin. What are the differences between them?
The picture below depicts electron micrographs of the major levels of chromatin structure. Match each of the listed conditions with the most likely levels of chromatin structure under that condition.
Distinguish between heterochromatin and euchromatin.
Chapter 12 Solutions
Concepts of Genetics (12th Edition)
Ch. 12 - In bacteriophages and bacteria, the DNA is almost...Ch. 12 - After salivary gland cells from Drosophila are...Ch. 12 - If a human nucleus is 10 m in diameter, and it...Ch. 12 - Roberts syndrome is a rare inherited disorder...Ch. 12 - Prob. 2CSCh. 12 - Roberts syndrome is a rare inherited disorder...Ch. 12 - HOW DO WE KNOW? In this chapter, we focused on how...Ch. 12 - CONCEPT QUESTION Review the Chapter Concepts list...Ch. 12 - Contrast the size of the single chromosome in...Ch. 12 - Describe the structure of giant polytene...
Ch. 12 - What genetic process is occurring in a puff of a...Ch. 12 - During what genetic process are lampbrush...Ch. 12 - Why might we predict that the organization of...Ch. 12 - Describe the sequence of research findings that...Ch. 12 - Describe the molecular composition and arrangement...Ch. 12 - Describe the transitions that occur as nucleosomes...Ch. 12 - Provide a comprehensive definition of...Ch. 12 - Mammals contain a diploid genome consisting of at...Ch. 12 - Assume that a viral DNA molecule is a 50-m-long...Ch. 12 - How many base pairs are in a molecule of phage T2...Ch. 12 - Examples of histone modifications are acetylation...Ch. 12 - Contrast the structure of SINE and LINE DNA...Ch. 12 - Variable number tandem repeats (VNTRs) are...Ch. 12 - It has been shown that infectious agents such as...Ch. 12 - Cancer can be defined as an abnormal proliferation...Ch. 12 - In a study of Drosophila, two normally active...Ch. 12 - Prob. 21ESPCh. 12 - An article entitled Nucleosome Positioning at the...Ch. 12 - Prob. 23ESPCh. 12 - Following is a diagram of the general structure of...Ch. 12 - Microsatellites are currently exploited as markers...Ch. 12 - At the end of the short arm of human chromosome 16...
Knowledge Booster
Learn more about
Need a deep-dive on the concept behind this application? Look no further. Learn more about this topic, biology and related others by exploring similar questions and additional content below.Similar questions
- Describe heterochromatin and euchromatin when viewed under an electron microscopearrow_forwardWhat is the molecular basis of genetic information? base sequences sugar-phosphate backbone chromatin supercoiling phospholipidsarrow_forwardLook at the picture carefully below and imagine inside a cell nucleus. a) encircle and name the parts where DNA is most accessible and least accessible b) how nucleosome positioning or spacing can interfere with DNA accessiblityarrow_forward
- Describe the structure of nucleosome ( please keep it short as much as you can ) .arrow_forwardMake a concept map that includes all of the terms below, and include illustrations of the central concepts. Draw arrows connecting the concepts as appropriate, and label the arrows to indicate the relationship between those concepts. Typically, nouns will be the nodes of the map. Verbs and connecting ideas should be written on the connecting arrows. Illustrations of the central phenomena (replication, transcription, translation) are mandatory, and you must develop your own pictures. You can draw them by hand or use a computer illustrating program to draw, but you may not screenshot images from the internet. DNA RNA protein replicates transcribes translates DNA Polymerase RNA Polymerase Sigma factor dNTP rNTP ribosome supercoiling gyrase origin of replication / OriC aminocoumarins gene operon promoter operator ORF (open reading frame) lacZ lacI lactose glucose Beta-galactosidase LacI 30S 50S 70S mRNA tRNA rRNA aminoglycoside macrolide chloramphenicol rifampin RBS (ribosome binding…arrow_forwardHeterochromatin has a less compact structure, whereas euchromatin is more compact and composed of an array of nucleosomes condensed into a fiber true or false?arrow_forward
- Explain why a particular gene might be present in heterochromatin in one cell and euchromatin in another.arrow_forwardBackground: DNA nucleotides (i.e A, T, G, and C) are naturally found in a paired, or bonded, arrangement (i.e. the double helix) within the nucleus of every cell. This structure makes the process of replication that occurs prior to mitosis and meiosis very reliable. The purpose of DNA, though, is not simply to make copies of itself, but to provide a set of instructions for the synthesis or "construction" of biomolecules, such as proteins. Why is transcription (i.e. the formation of an RNA copy of a given gene) a necessary step in the "construction" process highlighted above? What is the cell looking to ultimately do with this RNA information?arrow_forwardAs you should recall, DNA, when not being actively transcribed, has a double helical structure. This portion of the DNA has had the two strands separated in preparation of transcribing for a needed protein. The following is one of the two complimentary strands of DNA: 3' - AACCAGTGGTATGGTGCGATGATCGATTCGAGGCTAAAATACGGATTCGTACGTAGGCACT - 5' Q: Based on written convention, i.e. the 3'-5' orientation, is this the coding strand or the template strand? ______________________________ Q: Assuming this strand extends from base #1 to #61 (going left to right), interpret the correctly transcribed mRNA and translated polypeptide for bases 24 - 47: mRNA: ___-___-___-___-___-___-___-___-___-___-___-___-___-___-___-___-___-___-___-___-___-___-___-___- polypeptide chain: ________--________--________--________--________--________--________--________arrow_forward
- Which of the following is not true for chromatin?a) Organized structure of DNA and proteinb) These are highly condensed DNAc) It is found in the nucleusd) It contains a single dsDNAarrow_forwardMatch the definition on the left with the term on the right Tightly hypercolled DNA that is not in use Loosely colled DNA that is currently being used a) Chromatin b) Chromosomearrow_forwardDescribe the structure of DNA. The two strands of DNA are antiparallel. What does the term antiparallel mean? Describe how DNA is tightly packaged. Your description should include the terms histones, chromatin, nucleosomes and chromosomes.arrow_forward
arrow_back_ios
SEE MORE QUESTIONS
arrow_forward_ios
Recommended textbooks for you
- Human Anatomy & Physiology (11th Edition)BiologyISBN:9780134580999Author:Elaine N. Marieb, Katja N. HoehnPublisher:PEARSONBiology 2eBiologyISBN:9781947172517Author:Matthew Douglas, Jung Choi, Mary Ann ClarkPublisher:OpenStaxAnatomy & PhysiologyBiologyISBN:9781259398629Author:McKinley, Michael P., O'loughlin, Valerie Dean, Bidle, Theresa StouterPublisher:Mcgraw Hill Education,
- Molecular Biology of the Cell (Sixth Edition)BiologyISBN:9780815344322Author:Bruce Alberts, Alexander D. Johnson, Julian Lewis, David Morgan, Martin Raff, Keith Roberts, Peter WalterPublisher:W. W. Norton & CompanyLaboratory Manual For Human Anatomy & PhysiologyBiologyISBN:9781260159363Author:Martin, Terry R., Prentice-craver, CynthiaPublisher:McGraw-Hill Publishing Co.Inquiry Into Life (16th Edition)BiologyISBN:9781260231700Author:Sylvia S. Mader, Michael WindelspechtPublisher:McGraw Hill Education
Human Anatomy & Physiology (11th Edition)
Biology
ISBN:9780134580999
Author:Elaine N. Marieb, Katja N. Hoehn
Publisher:PEARSON
Biology 2e
Biology
ISBN:9781947172517
Author:Matthew Douglas, Jung Choi, Mary Ann Clark
Publisher:OpenStax
Anatomy & Physiology
Biology
ISBN:9781259398629
Author:McKinley, Michael P., O'loughlin, Valerie Dean, Bidle, Theresa Stouter
Publisher:Mcgraw Hill Education,
Molecular Biology of the Cell (Sixth Edition)
Biology
ISBN:9780815344322
Author:Bruce Alberts, Alexander D. Johnson, Julian Lewis, David Morgan, Martin Raff, Keith Roberts, Peter Walter
Publisher:W. W. Norton & Company
Laboratory Manual For Human Anatomy & Physiology
Biology
ISBN:9781260159363
Author:Martin, Terry R., Prentice-craver, Cynthia
Publisher:McGraw-Hill Publishing Co.
Inquiry Into Life (16th Edition)
Biology
ISBN:9781260231700
Author:Sylvia S. Mader, Michael Windelspecht
Publisher:McGraw Hill Education
Physiology of Sleep (Cycles and Waves); Author: USMLE pass;https://www.youtube.com/watch?v=LqY1Vn9y89A;License: Standard Youtube License