Genetics: Analysis and Principles
6th Edition
ISBN: 9781259616020
Author: Robert J. Brooker Professor Dr.
Publisher: McGraw-Hill Education
expand_more
expand_more
format_list_bulleted
Concept explainers
Question
Chapter 12.3, Problem 2COMQ
Summary Introduction
Introduction:
Regulatory sequences are present in -50 to -100 downstream of promotor yet strongly influence the rate of transcription. These are the short stretches of DNA sequences that control the attachment of RNA polymerase to core promotor and initiate transcription with sigma factors. There are two categories of regulatory sequences; activating sequences and deactivating sequences.
Expert Solution & Answer
Want to see the full answer?
Check out a sample textbook solutionStudents have asked these similar questions
Ribosomal RNA ____________________.
a. Carries amino acids to the ribosome
b. Carries information from the DNA to the ribosome
c. Helps make up the ribosome
d. Carries oxygen to cells
Prokaryotic transcripts are _____________ since several proteins can be produced from one mRNA.
a. polycistronic
b. monocistronic
c. tricistronic
d. bicistronic
Regulation of gene expression most typically occurs at the level of ______________.
Select one:
a.
transcription
b.
post-transcription
c.
post-translation
Chapter 12 Solutions
Genetics: Analysis and Principles
Ch. 12.1 - 1. Which of the following base sequences is used...Ch. 12.1 - Prob. 2COMQCh. 12.2 - With regard to a promoter, a transcriptional start...Ch. 12.2 - Prob. 2COMQCh. 12.2 - 3. Sigma factor is needed during which stage(s) of...Ch. 12.2 - A uracil-rich sequence occurs at the end of the...Ch. 12.3 - Which RNA polymerase in eukaryotes is responsible...Ch. 12.3 - Prob. 2COMQCh. 12.3 - Prob. 3COMQCh. 12.3 - Prob. 4COMQ
Ch. 12.4 - Which of the following are examples of RNA...Ch. 12.4 - A ribozyme is a. a complex between RNA and a...Ch. 12.4 - Prob. 3COMQCh. 12.4 - Prob. 4COMQCh. 12.5 - 1. Which of the following is not a key difference...Ch. 12 - Prob. 1CONQCh. 12 - Prob. 2CONQCh. 12 - Prob. 3CONQCh. 12 - Prob. 4CONQCh. 12 - 5. Mutations in bacterial promoters may increase...Ch. 12 - Prob. 6CONQCh. 12 - 7. In Chapter 9, we considered the dimensions of...Ch. 12 - 8. A mutation within a gene sequence changes the...Ch. 12 - Prob. 9CONQCh. 12 - At the molecular level, describe how factor...Ch. 12 - Prob. 11CONQCh. 12 - What is the complementarity rule that governs the...Ch. 12 - 13. Describe the movement of the open complex...Ch. 12 - 14. Describe what happens to the chemical bonding...Ch. 12 - Prob. 15CONQCh. 12 - Prob. 16CONQCh. 12 - Prob. 17CONQCh. 12 - Mutations that occur at the end of a gene may...Ch. 12 - If the following RNA polymerases were missing from...Ch. 12 - 20. What sequence elements are found within the...Ch. 12 - 21. For each of the following transcription...Ch. 12 - 22. Describe the allosteric and torpedo models for...Ch. 12 - Which eukaryotic transcription factor(s) shown in...Ch. 12 - 24. The initiation phase of eukaryotic...Ch. 12 - A eukaryotic protein-encoding gene contains two...Ch. 12 - 26. Describe the processing events that occur...Ch. 12 - Prob. 27CONQCh. 12 - Prob. 28CONQCh. 12 - Prob. 29CONQCh. 12 - Prob. 30CONQCh. 12 - 31. In eukaryotes, what types of modifications...Ch. 12 - Prob. 32CONQCh. 12 - Prob. 33CONQCh. 12 - 34. Figure 12.21 shows the products of alternative...Ch. 12 - 35. The processing of ribosomal RNA in eukaryotes...Ch. 12 - Prob. 36CONQCh. 12 - Prob. 37CONQCh. 12 - After the intron (which is in a lariat...Ch. 12 - Prob. 1EQCh. 12 - 2. Chapter 21 describes a technique known as...Ch. 12 - Prob. 3EQCh. 12 - As described in Chapter 21 and in experimental...Ch. 12 - Prob. 5EQCh. 12 - Prob. 6EQCh. 12 - 1. Based on your knowledge of introns and pre-mRNA...Ch. 12 - Discuss the types of RNA transcripts and the...
Knowledge Booster
Learn more about
Need a deep-dive on the concept behind this application? Look no further. Learn more about this topic, biology and related others by exploring similar questions and additional content below.Similar questions
- Please answer fast Type 1 diabetes results from a loss of insulin production from the pancreas. People with diabetes take recombinant human insulin expressed in bacteria. a. Describe the gene construct necessary for expression of human insulin in bacteria. b. Describe the gene construct necessary to produce human insulin in goat’s milk. c. If you were to attempt gene therapy (genetically modifying the human’s genome so that insulin would be produced in the human’s pancreas), would you need a recombinant form of the insulin gene? Explain your answer.arrow_forwardTranscription factors include ______________. a. silencers and enhancers b. promoters and insulators c. activators, repressors, and translational factors d. activators and repressors e. enhancers and repressorsarrow_forwardwhich of these describes the symptoms of the disease(s) caused by mutations in this gene CAGATTGTGAAGAGGTCTCTTGA? Select all that apply a. Thread-like blood vessels in eyes b. Excessive bleeding c. Dwarfism d. UV light sensitivity e. sunburn f. Bruisesarrow_forward
- Certain introns can self-excise from RNA. a. false b. truearrow_forwardA cell in this stage of cancer no longer makes the set of proteins that is was originally instructed to make but has not migrated into surrounding tissues; thus at this stage a tissue specific protein production profile could be used to identify a cancer. a. carcinoma, in situ b. dysplasia c. hyperplasia d. malignant tumorarrow_forwardWhich statements decribe the function of the protein encoded by this gene CAGATTGTGAAGAGGTCTCTTGA? A. Break point cluster region protein that may function as a GTPase B. A coagulation factor C. An enzyme involved in the breakdown of glycosaminoglycans (GAGs) D. Transcription factor involved in the DNA damage response E. A component of hemoglobin F. A tyrosine kinase G. Serine/threonine kinase involved in the DNA damage response H. A tumor suppressor involved in WNT signalling I. A DNA repair enzyme involved in nucleotide excision repairarrow_forward
- Which could lead to uncontrolled growth in cancer? A. A nonfunctional E2F protein B. The overexpression of MPF activity C. A nonfunctional Rb protein D. The overexpression of G1 cyclinarrow_forwardQuestion 1: The figure shows key components of gene transcription in a eukaryotic cell. Indicate what component (A to E) in the drawing corresponds to each of the following: Enhancers, Promoter Proximal Elements, Basal/General Transcription factor, Transcriptional Activators, Mediator Enhancers_______ Promoter Proximal Elements_________ Basal/General Transcription factor____________ Transcriptional Activators___________ Mediator______________ From the list above which proteins bind to enhancers/regulatory switches? Question 2. What is the role of TFIIH in eukaryotic transcription? How would a mutant of TFIIH that is deficient in kinase activity affect transcription? Answer:arrow_forwardDuring translation, __________________. a. A cell divides to make 2 new cells b. A cell divides to make 4 new cells c. DNA is used as a template to create mRNA d. mRNA, rRNA, and tRNA work together to make proteinsarrow_forward
- The attenuator is an important regulatory sequence that influence gene expression. The attenuator is located within a region called the ______________________________.arrow_forwardEpigenetic changes in gene regulation are caused by _ _ _ _ _ _ _ a. missing nucleotides or chromosomes b. modifications to histones and the DNA, but not the nucleotide sequence itself c. mutations of the nucleotide sequencearrow_forwardWhat will result from the binding of a transcription factor to an enhancer region? a. decreased transcription of an adjacent gene b. increased transcription of a distant gene c. alteration of the translation of an adjacent gene d. initiation of the recruitment of RNA polymerasearrow_forward
arrow_back_ios
SEE MORE QUESTIONS
arrow_forward_ios
Recommended textbooks for you
- Human Anatomy & Physiology (11th Edition)BiologyISBN:9780134580999Author:Elaine N. Marieb, Katja N. HoehnPublisher:PEARSONBiology 2eBiologyISBN:9781947172517Author:Matthew Douglas, Jung Choi, Mary Ann ClarkPublisher:OpenStaxAnatomy & PhysiologyBiologyISBN:9781259398629Author:McKinley, Michael P., O'loughlin, Valerie Dean, Bidle, Theresa StouterPublisher:Mcgraw Hill Education,
- Molecular Biology of the Cell (Sixth Edition)BiologyISBN:9780815344322Author:Bruce Alberts, Alexander D. Johnson, Julian Lewis, David Morgan, Martin Raff, Keith Roberts, Peter WalterPublisher:W. W. Norton & CompanyLaboratory Manual For Human Anatomy & PhysiologyBiologyISBN:9781260159363Author:Martin, Terry R., Prentice-craver, CynthiaPublisher:McGraw-Hill Publishing Co.Inquiry Into Life (16th Edition)BiologyISBN:9781260231700Author:Sylvia S. Mader, Michael WindelspechtPublisher:McGraw Hill Education
Human Anatomy & Physiology (11th Edition)
Biology
ISBN:9780134580999
Author:Elaine N. Marieb, Katja N. Hoehn
Publisher:PEARSON
Biology 2e
Biology
ISBN:9781947172517
Author:Matthew Douglas, Jung Choi, Mary Ann Clark
Publisher:OpenStax
Anatomy & Physiology
Biology
ISBN:9781259398629
Author:McKinley, Michael P., O'loughlin, Valerie Dean, Bidle, Theresa Stouter
Publisher:Mcgraw Hill Education,
Molecular Biology of the Cell (Sixth Edition)
Biology
ISBN:9780815344322
Author:Bruce Alberts, Alexander D. Johnson, Julian Lewis, David Morgan, Martin Raff, Keith Roberts, Peter Walter
Publisher:W. W. Norton & Company
Laboratory Manual For Human Anatomy & Physiology
Biology
ISBN:9781260159363
Author:Martin, Terry R., Prentice-craver, Cynthia
Publisher:McGraw-Hill Publishing Co.
Inquiry Into Life (16th Edition)
Biology
ISBN:9781260231700
Author:Sylvia S. Mader, Michael Windelspecht
Publisher:McGraw Hill Education
QCE Biology: Introduction to Gene Expression; Author: Atomi;https://www.youtube.com/watch?v=a7hydUtCIJk;License: Standard YouTube License, CC-BY