Foundations in Microbiology
10th Edition
ISBN: 9781259705212
Author: Kathleen Park Talaro, Barry Chess Instructor
Publisher: McGraw-Hill Education
expand_more
expand_more
format_list_bulleted
Concept explainers
Textbook Question
Chapter 9.1, Problem 7CYP
7. Name several characteristics of DNA structure that enable it to be replicated with such great accuracy generation after generation.
Expert Solution & Answer
Want to see the full answer?
Check out a sample textbook solutionStudents have asked these similar questions
26. You are a forensic scientist investigating a murder for the FBI. Foreign blood was found on the victim's body and you decide to create a DNA fingerprinting profile of the bloodstain along with several suspects. What technology would be best to separate the DNA fragments by their sizes?
- [ ] CRISPR
- [ ] PCR
- [ ] Restriction cloning
- [ ] Gel electrophoresis
- [ ] Gene therapy
27. An example of gene therapy is:
- [ ] Insertion of the insulin gene into the cells of a diabetic person
- [ ] Expression of the insulin gene in E. coli.
- [ ] Isolation of insulin from a pig.
- [ ] Injection of insulin into a diabetic person .
2. In an experiment conducted by Meselson and Stahl to confirm the DNA replication
process, the bacterial colony was transferred from its medium containing the isotope 1'N
nitrogen to a new medium containing normal 14N. The results of this experiment is
shown by the charts and the DNA diagrams below.
Experimental products chart
DNA diagram
Parent
DNA
14N
14N + 15N
BN
DNA densities
First
generation
DNA
14N
HN + 15N
BN
DNA densities
Second
generation
DNA
14N
14N + 15N
DNA densities
(a) Complete the diagram to show the DNA composition in the second generation.
(b) State the hypothesis which is supported by the experiment above.
(c) State ONE characteristic of the DNA structure which supports the hypothesis you
mention in (b).
(d) Name an enzyme involved in DNA replication.
2.
Dr. Kim at Ewha Research Center performed shotgun Sanger sequencing on an
unknown DNA sample, and obtained the following reads (12 reads). Since the length of each
read is quite short, Dr. Kim ran the original sample in a gel electrophoresis, and realized that
the original DNA is just 50 base pairs long. (Please note that the resolution of gel
electrophoresis is not so good. Thus, we cannot figure out the exact length of DNA using gel
electrophoresis in the real world.)
1) САСТС ССAGT GTACC T
3) GGAGT CAАТC GC
5) GGCTG TGCTT GG
7) GATGG CTGTG
9) CAGTG TACCT GCA
11) TGCAA GCGA G
2) AGCCG AGATG GCTG
4) CTGCA AGCCG A
6) CTTGG AGTCA ATCGC
8) САСТС ССAG
10) GCTGT GCTTG G
12) TGCTT GGAGT
(a}
Find the sequence of the original DNA (reconstruction), and align each read with
the reconstructed DNA sequence. (hint: put all reads on a ppt slide, and move them around
to find overlaps.)
(b)
Calculate coverage at each nucleotide position of the reconstructed DNA, i.e., how
many reads cover that…
Chapter 9 Solutions
Foundations in Microbiology
Ch. 9.1 - 1. Define heredity, genetics, genome, gene,...Ch. 9.1 - 2. Compare the basic nature of genetic material in...Ch. 9.1 - 3. Explain how DNA is organized and packaged.Ch. 9.1 - 4. Describe the chemical structure of DNA and Its...Ch. 9.1 - Prob. 5ELOCh. 9.1 - 6. Describe the process of DNA replication as it...Ch. 9.1 - 1. Compare the genetic material of eukaryotes,...Ch. 9.1 - 2. Characterize the organization of genetic...Ch. 9.1 - Prob. 3CYPCh. 9.1 - 4. What are the fundamental building blocks of DNA...
Ch. 9.1 - 5. Describe what is meant by the antiparallel...Ch. 9.1 - 6. Explain the synthesis of the leading and...Ch. 9.1 - 7. Name several characteristics of DNA structure...Ch. 9.2 - Prob. 7ELOCh. 9.2 - Prob. 8ELOCh. 9.2 - 9. Describe the different types of RNA and their...Ch. 9.2 - Prob. 10ELOCh. 9.2 - 11. Describe the genetic code, codons, and...Ch. 9.2 - 12. Recount the participants and steps in...Ch. 9.2 - Prob. 13ELOCh. 9.2 - 8. How is the language of a gene expressed?Ch. 9.2 - Prob. 9CYPCh. 9.2 - 10. Construct a table that compares the structure...Ch. 9.2 - Prob. 11CYPCh. 9.2 - Prob. 12CYPCh. 9.2 - Prob. 13CYPCh. 9.2 - Prob. 14CYPCh. 9.2 - 15. Briefly describe the events in translation.Ch. 9.2 - Prob. 16CYPCh. 9.2 - 17. Summarize how bacterial and eukaryotic cells...Ch. 9.2 - Prob. 18CYPCh. 9.3 - 14. Explain the functions of operons in bacterial...Ch. 9.3 - 15. Describe the main features of the lactose...Ch. 9.3 - 16. Describe the main features of repressible...Ch. 9.3 - 17. Summarize some aspects of genetic control by...Ch. 9.3 - 19. What is an operon? Describe the functions of...Ch. 9.3 - 20. Compare and contrast the lac operon and...Ch. 9.3 - Prob. 21CYPCh. 9.3 - 22. At which levels of DNA regulation do small...Ch. 9.4 - Prob. 18ELOCh. 9.4 - Summarize the causes and types of mutations and...Ch. 9.4 - Prob. 20ELOCh. 9.4 - Compare beneficial and detrimental effects of...Ch. 9.4 - Explain what is meant by the terms mutation and...Ch. 9.4 - Describe the primary causes, types, and outcomes...Ch. 9.4 - Explain the purposes behind replica plating and...Ch. 9.5 - Explain recombination in bacteria and what it...Ch. 9.5 - Describe the main features of conjugation and its...Ch. 9.5 - Prob. 24ELOCh. 9.5 - Identify the basic processes involved in...Ch. 9.5 - Discuss transposons and their importance to...Ch. 9.5 - Compare conjugation, transformation, and...Ch. 9.5 - Explain the differences between general and...Ch. 9.5 - By means of a flowchart, show the possible jumps...Ch. 9.6 - Explain the major elements of viral genetics.Ch. 9.6 - Compare aspects of the genetics of DNA and RNA...Ch. 9.6 - Explain why some viruses must enter the nucleus to...Ch. 9.6 - Explain the difference between positive-strand and...Ch. 9.6 - Outline the basic steps in the replication cycles...Ch. 9.L1 - What is the smallest unit of heredity (genotype)?...Ch. 9.L1 - Prob. 2MCQCh. 9.L1 - The nitrogen bases in DNA are bonded to the a....Ch. 9.L1 - DNA replication is considered semiconservative...Ch. 9.L1 - In DNA, adenine is the complementary base for...Ch. 9.L1 - The base pairs are held together primarily by a....Ch. 9.L1 - Why must the lagging strand of DNA be replicated...Ch. 9.L1 - Messenger RNA is formed by _______ of a gene on...Ch. 9.L1 - Prob. 9MCQCh. 9.L1 - Prob. 10MCQCh. 9.L1 - Prob. 11MCQCh. 9.L1 - Prob. 12MCQCh. 9.L1 - Prob. 13MCQCh. 9.L1 - Prob. 14MCQCh. 9.L1 - Which genetic material could be transmitted...Ch. 9.L1 - Prob. 16MCQCh. 9.L1 - Which of the following is present in prokaryotes...Ch. 9.L1 - Multiple Matching. Fill in the blanks with all the...Ch. 9.L1 - Prob. 1CSRCh. 9.L1 - Prob. 2CSRCh. 9.L1 - Explain how it would be possible for A. baumannii...Ch. 9.L1 - Prob. 1WCCh. 9.L1 - Prob. 2WCCh. 9.L1 - The following sequence represents triplets on DNA:...Ch. 9.L1 - Describe the actions οf all of the enzymes...Ch. 9.L1 - Prob. 5WCCh. 9.L1 - Examine the following series of words and identify...Ch. 9.L2 - Knowing that retroviruses operate on the principle...Ch. 9.L2 - Using the piece of DNA in writing-challenge...Ch. 9.L2 - Why will a mistake in the RNA code alone not...Ch. 9.L2 - The enzymes required to carry out transcription...Ch. 9.L2 - Prob. 5CTCh. 9.L2 - Activation, transcription, and translation of the...Ch. 9.L2 - Explain the mechanisms by which RNA can control...Ch. 9.L2 - Ex�Ιain how epigenetics is related to the...Ch. 9.L2 - Use the concepts of chapters, letters, a whole...Ch. 9.L2 - From figure 9.17, step 3. Label each part of the...Ch. 9.L2 - Examine figure 8.11, and explain which type of...
Knowledge Booster
Learn more about
Need a deep-dive on the concept behind this application? Look no further. Learn more about this topic, biology and related others by exploring similar questions and additional content below.Similar questions
- The results of a paternity test using short tandem repeats are listed in the table below. Whos the daddy? How sure are you?arrow_forward2. Dr. Kim at Research Center performed shotgun Sanger sequencing on an unknown DNA sample, and obtained the following reads (12 reads). Since the length of each read is quite short, Dr. Kim ran the original sample in a gel electrophoresis, and realized that the original DNA is just 50 base pairs long. (Please note that the resolution of gel electrophoresis is not so good. Thus, we cannot figure out the exact length of DNA using gel electrophoresis in the real world.) 2) AGCCG AGATG GCTG 4) CTGCA AGCCG A 1) САСТС ССAGT GTACC T 3) GGAGT CAATC GC 5) GGCTG TGCTT GG 7) GATGG CTGTG 9) CAGTG TACCT GCA 11) TGCAA GCCGA G 6) CTTGG AGTCA ATCGC 8) САСТС ССAG 10) GCTGT GСТTG G 12) TGCTT GGAGT (a) Find the sequence of the original DNA (reconstruction), and align each read with the reconstructed DNA sequence. (hint: put all reads on a ppt slide, and move them around to find overlaps.) (b) Calculate coverage at each nucleotide position of the reconstructed DNA, i.e., how many reads cover that…arrow_forward1. DNA plays an important role in two processes. During the process of replication, dna provides information to copy itself, so genetic information can be passed on from one generation of cells to the next. DNA also provides instructions for making proteins, in these instructions are vital to the maintenance and function of cells. DNA provides the information on how to order the amino acids required for making various proteins. Describe the significance of crude extraction of DNA from different sample organismic. 2. Distinguish the importance of the following theorems that are interrelated to the study of bioinformatics: (1) proteomics, (2) genomics, (3) biotechnology, (4) biostatistics, and (5) biological engineering. 3. Describe the procedures that you have encountered in the bacterial identification virtual laboratory (media.hhmi.org). Describe each part of the procedure: (1) simple preparation, (2) PCR amplification, (3) PCR purification, (4) sequencing preparation, (5) DNA…arrow_forward
- 9) The diagram to the right represents one technique used in biotechnology. The organic compound used to cut the bacterial DNA so that the human DNA could be inserted a(n)arrow_forward4. What is the name of the process by which bacteria pick up a different organism’s geneticmaterial?5. Genetically, how does the original bacterial DNA (plasmid) differ from the final bacterial DNAmolecule? (Do not say, “It is longer.”)6. Tetracycline is an antibiotic that is prescribed to kill bacterial infections. The transformedbacterial cell that you created has the tetracycline resistant gene in it. If this cell is placed on agrowth medium with tetracycline, will the bacteria grow or die? Explain.arrow_forward5. The nucleotide sequences of the DNA molecules in the figure below were obtained from four different individuals, one wild type and three mutants. Wild Type 5'-TTATCCATGATCGGATCGATCCATTAGCCGA-3' 3'-AATAGGTACTAGCCTAGCTAGGTAATCGGCT-5’ Mutant I 5'-ATCCATGATCGGATTGATCCATTAGCCGAAT-3’ 3'-TAGGTACTAGCCTAACTAGGTAATCGGCTTA-5’ Mutant II 5'-CCGTTATCCATGATCGGATAGATCCATTAGCC-3’ 3'-GGCAATAGGTACTAGCCTATCTAGGTAATCGG-5’ Mutant III 5'-CACCGTTATCCATGATCGGAACGATCCATTAGC-3’ 3'-CAGGCAATAGGTACTAGCCTTGCTAGGTAATCG-5’ a) Identify the open reading frames in each sequence of DNA and translate them into proteins. Write down the sequence of amino acids that will be obtained after translation: b) Which of the mutations above would be least likely to cause a change in the function of the protein? Why? c) Which of the mutations above would probably cause a major disruption in the function of the protein? Why?arrow_forward
- 4. Explain why Maurice Wilkins and Rosalin Franklin needed to use X-rays (instead of visible light) when "taking pictures" of crystalized DNA.arrow_forward1. The image shown in Figure 1 below represents a strand of DNA following replication. The black lines present above the top and below bottom strands of DNA represent the phosphodiester backbone of the molecule. Examine the DNA strands and locate any sites that are damaged, mismatched, or otherwise require repair. Indicate where in the strand the specific lesion is located, and provide a detailed overview of the post-replicative repair process that would likely be used to rectify the lesion. Assume that each lesion, even those that are located in close proximity will be repaired separately. CH, CH, OCH, CH, OCH₂CH, GATCCGAATCGGCTAGGATCGGCATCCGATTCGATCGGCATCCGATCGCTAGCO CH, CH, CH, CH, CH, TACGATCGATC CTAGGATTA CCGACCCTAGCCGTAGGGTAACGTAGCCGTAGGCTAGCGACCGGGGATGCTAGCTAG Figure 1: Graphical Representation of a strand of dsDNA containing errors and damage following replicationarrow_forward1. TRUE OR FALSE: a) Okazaki fragments are short DNA pieces that explain how the DNA polymerase can continue the synthesis of the new strand. b) Okazaki fragments are short DNA pieces that explain how the DNA polymerase can continue the synthesis of the new strand.arrow_forward
- 10. Taq polymerase, a DNA polymerase derived from thermophilic bacteria, is used in polymerase chain reactions (PCR) in the laboratory. During PCR, Taq catalyzes DNA polymerization, similar to how it would in bacteria. A normal PCR cycle is as follows:1. Melting/Denaturing 95°C2. Primer Annealing 50°C3. Elongation of DNA (repeat 20–30 cycles) 72°C Which of the following conditions likely describes the living environment of Taq bacteria?(A) Freshwater with acidic pH(B) Hydrothermal vents reaching temperatures between 70– 75°C(C) Hot springs of 40°C(D) Tide pools with high salinityarrow_forward13. Examine the following pattern of an electrophoresis gel and Draw a restriction map of the DNA. Is this DNA circular or linear? 1 2 1 3 0 4 5 6000 bp 5000 bp 4000 bp 3000 bp 2000 bp 1000 bp 500 bp Lane 1: DNA + EcoRI Lane 2: DNA + Hind III Lane 3: DNA + EcoR I +Hind III Lane 4: DNA only Lane 5: DNA ladderarrow_forward4. Meselson and Stahl's experiments examined DNA after 0, 20 and 40 minutes. Complete the table below to show the percentage of the DNA density after 60 minutes, assuming a) conservative replication and b) semi-conservative replication. Conservative replication Semi-conservative replication Time (mins) 14N/ 14N (light) 14N/15N (intermediate) 15N/15N (heavy) 40 60 40 60 75% 50% 50% 25% 5. What temperatures (°C) are typically used for each step of PCR? Denaturation Anneal primers DNA synthesisarrow_forward
arrow_back_ios
SEE MORE QUESTIONS
arrow_forward_ios
Recommended textbooks for you
- Biology (MindTap Course List)BiologyISBN:9781337392938Author:Eldra Solomon, Charles Martin, Diana W. Martin, Linda R. BergPublisher:Cengage LearningBiology: The Dynamic Science (MindTap Course List)BiologyISBN:9781305389892Author:Peter J. Russell, Paul E. Hertz, Beverly McMillanPublisher:Cengage LearningBiology: The Unity and Diversity of Life (MindTap...BiologyISBN:9781337408332Author:Cecie Starr, Ralph Taggart, Christine Evers, Lisa StarrPublisher:Cengage Learning
Biology (MindTap Course List)
Biology
ISBN:9781337392938
Author:Eldra Solomon, Charles Martin, Diana W. Martin, Linda R. Berg
Publisher:Cengage Learning
Biology: The Dynamic Science (MindTap Course List)
Biology
ISBN:9781305389892
Author:Peter J. Russell, Paul E. Hertz, Beverly McMillan
Publisher:Cengage Learning
Biology: The Unity and Diversity of Life (MindTap...
Biology
ISBN:9781337408332
Author:Cecie Starr, Ralph Taggart, Christine Evers, Lisa Starr
Publisher:Cengage Learning
Molecular Techniques: Basic Concepts; Author: Dr. A's Clinical Lab Videos;https://www.youtube.com/watch?v=7HFHZy8h6z0;License: Standard Youtube License