Foundations in Microbiology
10th Edition
ISBN: 9781259705212
Author: Kathleen Park Talaro, Barry Chess Instructor
Publisher: McGraw-Hill Education
expand_more
expand_more
format_list_bulleted
Concept explainers
Textbook Question
Chapter 9.L2, Problem 4CT
The enzymes required to carry out transcription and translation are themselves produced through these same processes. Speculate which may have come first in evolution—proteins or
Expert Solution & Answer
Want to see the full answer?
Check out a sample textbook solutionStudents have asked these similar questions
A thymine is changed to an adenine in one DNA codon which causes a particular
disorder. Which statement explains how the change in the DNA codon leads to
this disorder? *
O The frameshift mutation stops the production of a protein in the organism.
O The substitution causes a different protein to be produced in the organism.
O The insertion mutation caused the production of extra protein inthe organism.
The deletion mutation prevents the production of an important protein in the
organism.
Which type of mutations are the least harmful to an organism? *
O Duplication
Substitution
Insertion
god
The flow of genetic information is
from DNA-> RNA ->protein.
Use this figure to explain the
process.
Label the nucleus, DNA, mRNA,
ribosome, and amino acids.
Provide a brief discussion in support of the following statement: “RNA is believed to have played an important role during the origin of life.”
Chapter 9 Solutions
Foundations in Microbiology
Ch. 9.1 - 1. Define heredity, genetics, genome, gene,...Ch. 9.1 - 2. Compare the basic nature of genetic material in...Ch. 9.1 - 3. Explain how DNA is organized and packaged.Ch. 9.1 - 4. Describe the chemical structure of DNA and Its...Ch. 9.1 - Prob. 5ELOCh. 9.1 - 6. Describe the process of DNA replication as it...Ch. 9.1 - 1. Compare the genetic material of eukaryotes,...Ch. 9.1 - 2. Characterize the organization of genetic...Ch. 9.1 - Prob. 3CYPCh. 9.1 - 4. What are the fundamental building blocks of DNA...
Ch. 9.1 - 5. Describe what is meant by the antiparallel...Ch. 9.1 - 6. Explain the synthesis of the leading and...Ch. 9.1 - 7. Name several characteristics of DNA structure...Ch. 9.2 - Prob. 7ELOCh. 9.2 - Prob. 8ELOCh. 9.2 - 9. Describe the different types of RNA and their...Ch. 9.2 - Prob. 10ELOCh. 9.2 - 11. Describe the genetic code, codons, and...Ch. 9.2 - 12. Recount the participants and steps in...Ch. 9.2 - Prob. 13ELOCh. 9.2 - 8. How is the language of a gene expressed?Ch. 9.2 - Prob. 9CYPCh. 9.2 - 10. Construct a table that compares the structure...Ch. 9.2 - Prob. 11CYPCh. 9.2 - Prob. 12CYPCh. 9.2 - Prob. 13CYPCh. 9.2 - Prob. 14CYPCh. 9.2 - 15. Briefly describe the events in translation.Ch. 9.2 - Prob. 16CYPCh. 9.2 - 17. Summarize how bacterial and eukaryotic cells...Ch. 9.2 - Prob. 18CYPCh. 9.3 - 14. Explain the functions of operons in bacterial...Ch. 9.3 - 15. Describe the main features of the lactose...Ch. 9.3 - 16. Describe the main features of repressible...Ch. 9.3 - 17. Summarize some aspects of genetic control by...Ch. 9.3 - 19. What is an operon? Describe the functions of...Ch. 9.3 - 20. Compare and contrast the lac operon and...Ch. 9.3 - Prob. 21CYPCh. 9.3 - 22. At which levels of DNA regulation do small...Ch. 9.4 - Prob. 18ELOCh. 9.4 - Summarize the causes and types of mutations and...Ch. 9.4 - Prob. 20ELOCh. 9.4 - Compare beneficial and detrimental effects of...Ch. 9.4 - Explain what is meant by the terms mutation and...Ch. 9.4 - Describe the primary causes, types, and outcomes...Ch. 9.4 - Explain the purposes behind replica plating and...Ch. 9.5 - Explain recombination in bacteria and what it...Ch. 9.5 - Describe the main features of conjugation and its...Ch. 9.5 - Prob. 24ELOCh. 9.5 - Identify the basic processes involved in...Ch. 9.5 - Discuss transposons and their importance to...Ch. 9.5 - Compare conjugation, transformation, and...Ch. 9.5 - Explain the differences between general and...Ch. 9.5 - By means of a flowchart, show the possible jumps...Ch. 9.6 - Explain the major elements of viral genetics.Ch. 9.6 - Compare aspects of the genetics of DNA and RNA...Ch. 9.6 - Explain why some viruses must enter the nucleus to...Ch. 9.6 - Explain the difference between positive-strand and...Ch. 9.6 - Outline the basic steps in the replication cycles...Ch. 9.L1 - What is the smallest unit of heredity (genotype)?...Ch. 9.L1 - Prob. 2MCQCh. 9.L1 - The nitrogen bases in DNA are bonded to the a....Ch. 9.L1 - DNA replication is considered semiconservative...Ch. 9.L1 - In DNA, adenine is the complementary base for...Ch. 9.L1 - The base pairs are held together primarily by a....Ch. 9.L1 - Why must the lagging strand of DNA be replicated...Ch. 9.L1 - Messenger RNA is formed by _______ of a gene on...Ch. 9.L1 - Prob. 9MCQCh. 9.L1 - Prob. 10MCQCh. 9.L1 - Prob. 11MCQCh. 9.L1 - Prob. 12MCQCh. 9.L1 - Prob. 13MCQCh. 9.L1 - Prob. 14MCQCh. 9.L1 - Which genetic material could be transmitted...Ch. 9.L1 - Prob. 16MCQCh. 9.L1 - Which of the following is present in prokaryotes...Ch. 9.L1 - Multiple Matching. Fill in the blanks with all the...Ch. 9.L1 - Prob. 1CSRCh. 9.L1 - Prob. 2CSRCh. 9.L1 - Explain how it would be possible for A. baumannii...Ch. 9.L1 - Prob. 1WCCh. 9.L1 - Prob. 2WCCh. 9.L1 - The following sequence represents triplets on DNA:...Ch. 9.L1 - Describe the actions οf all of the enzymes...Ch. 9.L1 - Prob. 5WCCh. 9.L1 - Examine the following series of words and identify...Ch. 9.L2 - Knowing that retroviruses operate on the principle...Ch. 9.L2 - Using the piece of DNA in writing-challenge...Ch. 9.L2 - Why will a mistake in the RNA code alone not...Ch. 9.L2 - The enzymes required to carry out transcription...Ch. 9.L2 - Prob. 5CTCh. 9.L2 - Activation, transcription, and translation of the...Ch. 9.L2 - Explain the mechanisms by which RNA can control...Ch. 9.L2 - Ex�Ιain how epigenetics is related to the...Ch. 9.L2 - Use the concepts of chapters, letters, a whole...Ch. 9.L2 - From figure 9.17, step 3. Label each part of the...Ch. 9.L2 - Examine figure 8.11, and explain which type of...
Knowledge Booster
Learn more about
Need a deep-dive on the concept behind this application? Look no further. Learn more about this topic, biology and related others by exploring similar questions and additional content below.Similar questions
- A biologist inserted a gene from a human liver cell into the DNA of a bacterium. The bacteriumthen transcribed this gene into mRNA and translated the mRNA into protein. The proteinproduced was useless; it contained many more amino acids than the protein made by the humanliver cell and the amino acids were in a different sequence. Explain how this happened.arrow_forwardExplain why the statement is true. In the course of evolution of protein synthesis in the eukaryotic cell, the ability to perform Dehydration Synthesis to form the peptide bonds between amino acids is associated with: the rough endoplasmic reticulumarrow_forwardTransfer RNA is the molecule thata. contributes to the structure of ribosomesb. adapts the genetic code to protein structurec. transfers the DNA code to mRNAd. provides the master code for amino acidsarrow_forward
- Biology textbooks once taught the conceptof “one gene, one protein”—that a gene isa segment of DNA that codes for just oneprotein, and every protein is represented bya separate, unique gene. Discuss the evidence that shows that this can no longer beregarded as true.arrow_forwardViewo History Bookmarkad Window Help A moodle.Isu.edu Question 6 Polnts out of 5.00 P Flag question Not yet answered Given the sequences of DNA and translated protein as the following 1 atggettacagcgaaaaagttatcgaccattacgagaatccgcgt MAYS EK V IDHY ENPR 46 aacgtggattecttto NVG SFDN NDE N 91 atggtgggggcaccggcctatggcga MVGA 136 aaagtcaacgatgaaggtatcattgaagacgcqcgttttaaaact K V gacgagaacqtcggcagcage VG SG gttqcagatt L QI C G D K N DE G II E DA R. FKT If nucleotide a46 is mutated to g, Select one: O a. At DNA level, it is a transversion mutation. At protein level, it is a silent mutation. O b. At DNA level, it is a transversion mutation. At protein level, it is a missense mutation. Oc. At DNA level, it is a transition mutation. At protein level, it is a missense mutation. O d. At DNA level, it is a transition mutation. At protein level, it is a silent mutation. Time left 0:45:40 MacBook Air 吕口, 888 4 esc F2 Fa FS 2$ & 7 2 3 5 6 8 9 Q W E T Y tab A S D F K Faps lock C V Barrow_forwardA thymine is changed to an adenine in one DNA codon which causes a particular disorder. Which statement explains how the change in the DNA codon leads to this disorder? * O The frameshift mutation stops the production of a protein in the organism. O The substitution causes a different protein to be produced in the organism. The insertion mutation caused the production of extra protein in the organism. The deletion mutation prevents the production of an important protein in the organism. Which type of mutations are the least harmful to an organism? * Duplication O Substitution Insertionarrow_forward
- What would be the base sequence of the DNA strandacross from ATTGACTCG? If a DNA molecule was knownto be 20% adenine, predict its percentage of cytosineand explain your answer.arrow_forwardA DNA sequence such as the one shown below has symmetry. 5' TGGAATTGTGAGCGGATAACAATT 3 3' ACCTTAACACTCGCCTATTGTTAA 5arrow_forwardResearchers have reported advances in their attempts to synthesize life from scratch in a test-tube—bringing non-living matter to life. In the lab, they have been able to produce ‘protocells’ from fatty molecules that can spontaneously trap pieces of nucleic acids that possess the code for replication and metabolism. With continued progress, protocells may be synthesized that form self-replicating, evolving system that satisfy the conditions of life. Consider the scientific understanding that may be generated from this project. What scientific questions might the knowledge generated from this project help answer? Reflect on the broader significance of this work. What objections might be raised about this line of research?arrow_forward
- Explain the following relationship: DNA formats RNA, which makes proteins.arrow_forwardMiller-Urey type experiments have shown that simple organic molecules like amino acids can be produced from inorganic material. While this offers a first step in explaining how life came to be, it does not explain how complex life came to be. It is thought that RNA may have played an important role in transitioning from a world without life to a world with cells, particularly because of RNA’s ability to form ribozymes. Why are ribozymes important? Ribozymes are able to build DNA. Ribozymes can be held inside a vesicle. Ribozymes are able to catalyze reactions and replicate themselves. Ribozymes are the simplest macromolecules able to contain genetic information.arrow_forwardbeadle and tatum proposed the one-gene-one-polypeptide hypothesis. is this true for prokaryotes and eukaryotes? explain your answer in not more than five sentencesarrow_forward
arrow_back_ios
SEE MORE QUESTIONS
arrow_forward_ios
Recommended textbooks for you
- Human Anatomy & Physiology (11th Edition)BiologyISBN:9780134580999Author:Elaine N. Marieb, Katja N. HoehnPublisher:PEARSONBiology 2eBiologyISBN:9781947172517Author:Matthew Douglas, Jung Choi, Mary Ann ClarkPublisher:OpenStaxAnatomy & PhysiologyBiologyISBN:9781259398629Author:McKinley, Michael P., O'loughlin, Valerie Dean, Bidle, Theresa StouterPublisher:Mcgraw Hill Education,
- Molecular Biology of the Cell (Sixth Edition)BiologyISBN:9780815344322Author:Bruce Alberts, Alexander D. Johnson, Julian Lewis, David Morgan, Martin Raff, Keith Roberts, Peter WalterPublisher:W. W. Norton & CompanyLaboratory Manual For Human Anatomy & PhysiologyBiologyISBN:9781260159363Author:Martin, Terry R., Prentice-craver, CynthiaPublisher:McGraw-Hill Publishing Co.Inquiry Into Life (16th Edition)BiologyISBN:9781260231700Author:Sylvia S. Mader, Michael WindelspechtPublisher:McGraw Hill Education
Human Anatomy & Physiology (11th Edition)
Biology
ISBN:9780134580999
Author:Elaine N. Marieb, Katja N. Hoehn
Publisher:PEARSON
Biology 2e
Biology
ISBN:9781947172517
Author:Matthew Douglas, Jung Choi, Mary Ann Clark
Publisher:OpenStax
Anatomy & Physiology
Biology
ISBN:9781259398629
Author:McKinley, Michael P., O'loughlin, Valerie Dean, Bidle, Theresa Stouter
Publisher:Mcgraw Hill Education,
Molecular Biology of the Cell (Sixth Edition)
Biology
ISBN:9780815344322
Author:Bruce Alberts, Alexander D. Johnson, Julian Lewis, David Morgan, Martin Raff, Keith Roberts, Peter Walter
Publisher:W. W. Norton & Company
Laboratory Manual For Human Anatomy & Physiology
Biology
ISBN:9781260159363
Author:Martin, Terry R., Prentice-craver, Cynthia
Publisher:McGraw-Hill Publishing Co.
Inquiry Into Life (16th Edition)
Biology
ISBN:9781260231700
Author:Sylvia S. Mader, Michael Windelspecht
Publisher:McGraw Hill Education
What is Genomics - Full Length; Author: Genome BC;https://www.youtube.com/watch?v=mmgIClg0Y1k;License: Standard youtube license