Take home Question - Given the roles of DNA and RNA in the central dogma, why does it make sense that RNA is so much less stable than DNA?
Q: N-(2-hydroxyethyl)piperazine-N'-(2-ethanesulfonic acid) buffer at pH 7 with 400 mM NaCl. A A…
A: The principle of equilibrium states that when the two compartments are separated by a semi-permeable…
Q: 5.13) The NADH that is produced by glycolysis is not able to pass through the inner mitochondrial…
A: Oxidative phosphorylation is a process of ATP synthesis that occurs in the mitochondria. It involves…
Q: 3)Consider the following sequence: 5' - AUGGCUACAGAUAGCUGGGGCUGAAAAAAAAAAAAAAA..3' Translated, the…
A: A protein sequence is a linear sequence of amino acids, which are linked together by peptide bonds.…
Q: The image below shows the ATP cycle. From the statements below, select the correct statement about…
A: ATP stands for adenosine triphosphate. It is very crucial molecule that serves as the primary energy…
Q: List the most likely cellular component or organelle that houses each of the following…
A: Proteins are high molecular weight polymers that serve diverse functional roles in cells. They…
Q: Given the melting profile of a membrane bilayer consisting of (see attached diagrams) where R =…
A: The graph here has degree of fluidity as Y-axis and temperature as X-axis. The curve will shift to…
Q: 6. The initial velocity, vo, of an enzyme-catalyzed reaction reaches Vmax— at [S] = 10KM. at [S] =…
A: The rate of enzyme catalysed reactions depends on various factors. One of the factor is substrate…
Q: strate about the Map and sequence the genomes of several model organisms used in experimental…
A: In genetics, molecular biology, and in various research genome mapping is important. It is basically…
Q: Which of the following enzymes does not take part in the TCA cycle? Fumarase.…
A: The tricarboxylic acid cycle or TCA cycle catalyses the oxidation of citrate to regenerate…
Q: What is a Polyglycolic acid
A: Polyglycolic acid: Polyglycolic acid (PGA) is a synthetic biomaterial that belongs to the family of…
Q: hydrogenation be optimized to achieve high selectivity and conversion
A: Hydrogenation: Hydrogenation is a chemical process that involves the addition of hydrogen (H2) to…
Q: In this question, you need to discuss the results you obtained from the BSA standards to generate…
A: The BSA (Bovine Serum Albumin) assay is used to spectrophotometrically find the concentration of…
Q: why would you give 2 answers when clearly it is a multiple choice question with one answer
A: We know that the amino acid sequence of a polypeptide synthesized with respect to an mRNA is based…
Q: Define: simple diffusion, facilitated diffusion, primary active transport, secondary active…
A: simple diffusion: Nonpolar molecules move across concentration gradient (downhill process) in an…
Q: Imagine that you repeat the tRNA Selection experiment with modifications as follows: 1. Synthesize…
A: We know that the amino acid sequence of a polypeptide synthesized with respect to an mRNA is based…
Q: What reactions of respiration are considered the tricarboxylic acid cycle? Select one or more: a.…
A: The Tricarboxylic Acid Cycle, also known as the Krebs cycle or the citric acid cycle, is a series of…
Q: 14. In competitive inhibition, an inhibitor— binds reversibly at the active site. binds to both…
A: Enzymes are biological catalysts that increase the rate of chemical reactions in living organisms…
Q: Question: Role of the triacyl glycerol cycle. Summarize the cycle referring to Figure 19.9. What…
A: Triacylglycerol (TAG) or triacylglycerides or triglycerides or simple fat or fat refers to the fatty…
Q: Why are ATP's phosphoanhydride bonds high energy? Why is ATP hydrolysis so favorable?
A: ATP or Adenosine Triphosphate is a molecule that provides energy for the various cellular processes.…
Q: 10.94 Solution X has a pH of 9.0, and solution Y has a pH of 7.0. (10.6) a. Which solution is more…
A: pH is a measure of the acidity or basicity of a solution. It is defined as the negative logarithm of…
Q: Drag and drop the statements to the correct box: Enzymes DO: Decrease required activation energy…
A: Proteins that function as catalysts in biological reactions are known as enzymes. They function by…
Q: Figure 3 shows the results of an oral glucose tolerance test (OGTT) from a subject with diabetes.…
A: Oral glucose tolerance test is a test to measure the response of body to the glucose it intakes. It…
Q: 14. What are the functions of nucleic acids? Please explain
A: Nucleic acids store, transmit, and express genetic information. They're essential to life. Nucleic…
Q: You are a liver cell and have just been given 1 million C25:0 fatty acid molecules (Note: These…
A: As a liver cell, you have the ability to generate net production of glucose through a process called…
Q: What phosphate buffer conditions can be used to isolate protein (isoelectric point of 5.2) using…
A: Ion exchange chromatography is a process that allows the separation of ions and polar molecules…
Q: His-64 is an amino acid in myoglobin's herne-binding pocket. It is called the "distal histidine." A…
A: Myoglobin is a oxygen carrying protein similar to hemoglobin, present in muscle tissues that is…
Q: 1. Which is false about metabolic regulation? A: reactions with a large negative delta G are likely…
A: Metabolic regulation is the control and coordination of metabolic pathways and processes within an…
Q: Suppose you do an experiment in which you add to the inhibited culture (i.e., phosphoglucose…
A: In animal tissues, glucose has two possible fates: be oxidised into carbon dioxide and water by…
Q: Based on the list of intra- and extracellular concentrations shown below, ( ) is probably used as a…
A: Change in Gibbs free energy (∆G) of ion transport is given by the equation shown below. ∆G = ZF∆ψ +…
Q: THE SCIENTIFIC METHOD: DR. SEMMELWEIS’ CASE STUDY An example of the scientific method in action can…
A: The scientific method is a methodical strategy for problem-solving that is employed by scientists in…
Q: 7. An enzyme-catalyzed reaction proceeds by the mechanism below: E+S1→ES --2E+P E+A 3 EA EA+S4EAS -5…
A: The Rapid Equilibrium Assumption (REA) refers to the assumption that the formation of the…
Q: One hundred (100) ml of raw goat's milk bought from a street vendor is added in bottle 1 which…
A: In serial dilution, we systematically dilute the sample by transferring a small amount of the sample…
Q: 2. Based on biochemical and physiological mechanisms, how can you explain impaired brain development…
A: Uncontrolled Phenylketonuria (PKU) impairs brain development. This answer discusses the biochemical…
Q: 14.10) DNA contains the "information" needed for life. This information enables cells to grow and…
A: The double helix structure of DNA is an essential feature that allows for the storage and…
Q: Discuss the different factors that can affect enzyme activity.
A: Living organisms use enzymes to catalyse biochemical reactions. They accelerate chemical reactions…
Q: Is Raffinose tri-saccharide a reducing sugar? Explain the chemistry of the reducing sugar test and…
A: Raffinose is a trisaccharide consisting of galactose, glucose, and fructose as its constituent sugar…
Q: A 78-year-old lady receiving treatment for hypertension was investigated by her doctor by monitoring…
A: Minerals play a major role in the maintenance of the body's various physiological processes. They…
Q: Describe the oxidative and non oxidative phases of Pentose phosphate pathways discusss how the…
A: The pentose phosphate pathway (PPP) is a metabolic pathway that occurs in the cytoplasm of cells. It…
Q: The reaction in gluconeogenesis catalyzed by Glyceraldehyde-3-phosphate dehydrogenase (GADPH)…
A: Gluconeogenesis is the metabolic pathway that generates glucose from non-carbohydrate precursors.…
Q: How many acetyl CoA are produced from the complete B oxidation of lauric acid, CH3- (CH₂) 10-COOH, a…
A: β-oxidation is a metabolic process in which fatty acids are broken down into acetyl-CoA molecules…
Q: Below are three case scenarios. For each scenario determine: 1. Most likely enzyme deficiency and…
A: These three case studies illustrate various illnesses connected to the metabolism of amino acids. We…
Q: Which of the following could create different versions of an enzyme? (Select all that apply) Note:…
A: The genetic information in the cell is stored in the sequence of nucleotides present in DNA , the…
Q: glucose + 6 O2 ? 6 CO2 + 6 H2O + Energy Show the reactions that remove these 6CO2 molecules.
A: This is the process of cellular respiration, which occurs in all living cells to break down glucose…
Q: Mutation 1: H to E Mutation 2: H to N Mutation 3: S to D Mutation 4: S to C
A: The catalytic activity of an enzyme depends heavily on the functional group or the amino acids in…
Q: H3C CH3 1. After the whole fatty acid molecule is completely broken down, how many molecules of…
A: Beta oxidation is the breakdown of fatty acids into acetyl CoA and other products based on carbon…
Q: Is transported into the cytosol, citrulline reacts with aspartate to produce argininosuccinate…
A: The urea cycle is a chemical cycle. It mainly occurs in the liver. Its purpose is to eliminate the…
Q: Describe how the cholesterol from the burger ultimately gets to your liver. In Your answer mention…
A: A metabolic pathway is a series of interconnected chemical reactions that occur within a cell or…
Q: Which of the following is not true about enzymes?
A: The question concerns enzymes and their characteristics. Biochemical catalysts known as enzymes are…
Q: Based on the image below, select the correct statements. Note: There may be more than 1 correct…
A: Purines are a heterocyclic organic compound that has 5-member rings fused to a 6-member ring.…
Q: Which of the following are mechanisms that prevent the liver from using up glucose that is more…
A: Glucose homeostasis is the process of maintaining a steady and constant level of glucose in the…
Step by step
Solved in 3 steps
- 10. A portion of 5'-AUGCCACGAGUUGAC-3'. What amino acid sequence does this code for? To answer the question please: I) explain what is the genetic code and list the properties of the genetic e 2) draw a diagram of protein synthesis; 3) determine which tRNA should be attached to the mRNA; 4) what is the anticodon for the very first tRNA that will attach to mRNA? mRNA molecule has the sequence ana. Do any strands of nucleic acid exist in nature inwhich part of the strand is DNA and part is RNA?If so, describe when such strands of nucleic acidare synthesized. Is the RNA component at the 5′end or at the 3′ end?b. RNA primers in Okazaki fragments are usually veryshort, less than 10 nucleotides and sometimes asshort at 2 nucleotides in length. What does this facttell you about the processivity of the primaseenzyme—that is, the relative ability of the enzymeto continue polymerization as opposed to dissociatingfrom the template and from the molecule beingsynthesized? Which enzyme is likely to have a greaterprocessivity, primase or DNA polymerase III?Within a protein, certain amino acids are positively charged (e.g.,lysine and arginine), some are negatively charged (e.g., glutamateand aspartate), some are polar but uncharged, and some are nonpolar.If you knew that a DNA-binding protein was recognizingthe DNA backbone rather than a base sequence, which aminoacids in the protein would be good candidates for interacting withthe DNA?
- A DNA-binding protein recognizes the following double-strandedsequence:5′–GCCCGGGC–3′3′–CGGGCCCG–5′This type of double-stranded structure could also occur withinthe stem region of an RNA stem-loop. Discuss the structural differencesbetween RNA and DNA that might prevent the DNAbindingprotein from recognizing a double-stranded RNA molecule.The hydrophobic effect explains why: O Water regulates pH in the interstitial fluid between eukaryotic cells. O Salt bridges form between oppositely charged histones and DNA in an aqueous environment. Nitrogenous bases are in the interior of the helix, when DNA is in an aqueous environment. Oil forms a homogenous mixture with polar solvents, like acetone.Discuss the structural significance of complementarity in DNAand in RNA.
- RNA shares with proteins the ability to fold intocomplex three-dimensional shapes. As a result, RNAmolecules can, like protein molecules, catalyze biochemical reactions (that is, both kinds of moleculescan act as enzymes, or biological catalysts). Thesestatements are not true of DNA. Why can someRNA molecules act as enzymes whereas DNAmolecules cannot? (Hint: Most RNA moleculesconsist of a single strand of nucleotides while mostDNA molecules are double helixes made of twostrands of nucleotides.)Consider normal B-form DNA. It forms a regular antiparallel double-helical structure with Watson-Crick base-pairing mediated through hydrogen bonding. The base pairs all stack upon one another, with 3.4 Å spacing between them. DNA strands having a complementary sequence will spontaneously form a double-helix in an aqueous solution. In terms of energy, what primarily drives helix formation? O Positive Entropy from base stacking van der Waals interactions O Hoogsteen interactions Positive Enthalpy from Hydrogen Bonding between GC and AT pairs Negative Enthalpy from Hydrogen Bonding between GC and AT pairs O Negative Entropy from base stackingDNA 5' ATGGCTTCTCAATACTGCTTTGTTTTGGTT 3' template strand 3' TACCGAAGAGTTATGACGAAACAAAACCAA 5' coding strand Write down the sequence of nucleotides in a fragment of an m-RNA molecule that will be produced based on the information in the DNA fragment above (start with 5' and end with 3'). If you separate codons in MRNA with blank spaces, it will be easier to do the next step. MRNA: 5' Using a three-letter code for amino acids write the sequence of the first ten amino acids of the protein pectate lyase (refer to the table of 64 codons from a lecture or a textbook).
- 5’-GTCGTATAGTGA-3’ 3’-CAGCATATCACT-5’ if this is the dna sequence is the RNA sequence this 3’-GTCGTATAGTGA-5’, give reason if it not correctMolecular Biology (Biol-L211) Dr. Nole Central Dogma Practice - Processes The general flow of genetic information is diagrammed below. Think carefully about what type of molecule is represented by each item in the diagram and clearly address each of the following. A. Label each structure as mature mRNA, pre-mRNA, protein, or DNA. B. Label each arrow to indicate which is processing, transcription, replication, and translation. C. Identify the general location (on the appropriate molecule) of the promoter sequence and the terminator sequence. D. Identify the specific location of the place where the start codon and stop codon function most directly (i.e., which molecule is actually translated?). E. Where does RNA polymerase bind to begin transcription? F. Where specifically does the ribosome bind to begin translation-i.e., what are the ribosome binding sites (in both prokaryotes and eukaryotes) and where are they found? G. Label each end of the mature mRNA and the polypeptide to correctly…Molecular Biology (Biol-L211) Dr. Nole Central Dogma Practice - Processes The general flow of genetic information is diagrammed below. Think carefully about what type of molecule is represented by each item in the diagram and clearly address each of the following. A. Label each structure as mature mRNA, pre-mRNA, protein, or DNA. B. Label each arrow to indicate which is processing, transcription, replication, and translation. C. Identify the general location (on the appropriate molecule) of the promoter sequence and the terminator sequence. D. Identify the specific location of the place where the start codon and stop codon function most directly. E. Where does RNA polymerase bind to begin transcription? F. Where specifically does the ribosome bind to begin translation-i.e., what are the ribosome binding sites and where are they found? G. Label each end of the mature mRNA and the polypeptide to correctly specify polarity. (You should use the labels 3', 5', C-terminus, and N-terminus.)