BIOLOGY:THE ESSENTIALS (LL) W/CONNECT
3rd Edition
ISBN: 9781260670929
Author: Hoefnagels
Publisher: MCG CUSTOM
expand_more
expand_more
format_list_bulleted
Question
Chapter 7, Problem 16WIO
Summary Introduction
To determine:
The reason for the fact that despite the amount of melanin being controlled by the genes, it is not a protein.
Introduction:
Melanin is a pigment that is present inside the living organism for the regulation of skin color. The amount of melanin in the skin is controlled by the activities of various genes.
Expert Solution & Answer
Want to see the full answer?
Check out a sample textbook solutionStudents have asked these similar questions
Xeroderma pigmentosum is an inherited disorder characterized by rapid formation of many skin sores that develop into cancers. All forms of radiation trigger these symptoms, including fluorescent light, which contains UV light in the range of 320 to 400 nm. In most affected individuals, at least one of nine particular proteins is missing or defective. What is the collective function of these proteins?
Albinism (achromia) is a genetic condition in which an individual cannot synthesize melanin from tyrosine (an amino acid), a brown pigment of the hair, skin, and eyes. These individuals lack whar?
The alpha-keratin of hair is rich in the amino acid cysteine. The location of these cysteines in the protein chain is genetically determined. As a result of the location of the cysteines in the protein, a person may have curly, wavy, or straight hair. How can the location of cysteines in a-keratin result in these different styles of hair? Propose a hypothesis to explain how a “perm” causes straight hair to become curly
Chapter 7 Solutions
BIOLOGY:THE ESSENTIALS (LL) W/CONNECT
Ch. 7.1 - Prob. 1MCCh. 7.1 - Prob. 2MCCh. 7.2 - Prob. 1MCCh. 7.2 - Prob. 2MCCh. 7.2 - Prob. 3MCCh. 7.3 - Prob. 1MCCh. 7.3 - Prob. 2MCCh. 7.3 - Prob. 3MCCh. 7.3 - Prob. 4MCCh. 7.3 - Prob. 5MC
Ch. 7.4 - Prob. 1MCCh. 7.4 - Prob. 2MCCh. 7.4 - Prob. 3MCCh. 7.5 - Prob. 1MCCh. 7.5 - Prob. 2MCCh. 7.5 - Prob. 3MCCh. 7.5 - Prob. 4MCCh. 7.5 - Prob. 5MCCh. 7.6 - Prob. 1MCCh. 7.6 - Prob. 2MCCh. 7.6 - Prob. 3MCCh. 7.7 - Prob. 1MCCh. 7.7 - Prob. 2MCCh. 7.7 - Prob. 3MCCh. 7.7 - Prob. 4MCCh. 7.8 - Prob. 1MCCh. 7.8 - Prob. 2MCCh. 7.8 - Prob. 3MCCh. 7.8 - Prob. 4MCCh. 7.8 - Prob. 5MCCh. 7.9 - Prob. 1MCCh. 7.9 - Prob. 2MCCh. 7.10 - Prob. 1MCCh. 7.10 - Prob. 2MCCh. 7 - If one strand of DNA has the sequence ATTGTCC,...Ch. 7 - Transcription copies a _____ to a complementary...Ch. 7 - Prob. 3MCQCh. 7 - Prob. 4MCQCh. 7 - Prob. 5MCQCh. 7 - Prob. 6MCQCh. 7 - At which stage in viral replication does the...Ch. 7 - Prob. 8MCQCh. 7 - Prob. 1WIOCh. 7 - Prob. 2WIOCh. 7 - Prob. 3WIOCh. 7 - Prob. 4WIOCh. 7 - Prob. 5WIOCh. 7 - Prob. 6WIOCh. 7 - Prob. 7WIOCh. 7 - Prob. 8WIOCh. 7 - How many codons are in the mRNA molecule that you...Ch. 7 - Prob. 10WIOCh. 7 - Prob. 11WIOCh. 7 - Prob. 12WIOCh. 7 - Prob. 13WIOCh. 7 - Prob. 14WIOCh. 7 - Prob. 15WIOCh. 7 - Prob. 16WIOCh. 7 - Prob. 17WIOCh. 7 - Prob. 18WIOCh. 7 - Prob. 19WIOCh. 7 - Prob. 20WIOCh. 7 - Prob. 21WIOCh. 7 - Prob. 1SLCh. 7 - Prob. 1PITCh. 7 - Where do promoters, terminators, stop codons,...Ch. 7 - Prob. 3PITCh. 7 - Review the Survey the Landscape figure in the...
Knowledge Booster
Learn more about
Need a deep-dive on the concept behind this application? Look no further. Learn more about this topic, biology and related others by exploring similar questions and additional content below.Similar questions
- A mutation leads to a change in one amino acid in a protein. The result is that the protein no longer functions properly. How is this possible?arrow_forwardThe protein known as tyrosinase is needed to make certain types of pigments. Tyrosinase is composed of a single polypeptide with 511amino acids. The molecular mass of this protein is approximately61,300 Da, or 61.3 kDa. People who carry two defective copies ofthe tyrosinase gene have the condition known as albinism. They areunable to make pigment in the skin, eyes, and hair. Western blottingis used to detect proteins that are translated from a particularmRNA. This method is described in Chapter 20 and also in experimentalquestion E4. Skin samples were collected from a pigmentedindividual (lane 1) and from three unrelated albino individuals(lanes 2, 3, and 4) and subjected to a Western blot analysis using anantibody that recognizes tyrosinase.arrow_forwardIn many genetic disorders, a lysosomal enzyme required to degrade a specific molecule is missing or defective. One example of these maladies, often referred to as lysosomal storage diseases, is Tay-Sachs disease. Afflicted individuals inherit a defective gene from each parent that codes for an enzyme that degrades a complex lipid molecule. Symptoms include severe mental retardation and death before the age of 5 years. What is the nature of the process that is destroying the patient's cells? (Hint: Synthesis of the lipid molecule continues at a normal rate.)arrow_forward
- Hemoglobin is a complex protein that contains four polypeptide chains. The normal hemoglobin found in adults—called adult hemoglobin— consists of two alpha and two beta polypeptide chains, which are encoded by different loci. Sickle-cell hemoglobin, which causes sicklecell anemia, arises from a mutation in the beta chain of adult hemoglobin. Adult hemoglobin and sickle-cell hemoglobin differ in a single amino acid: the sixth amino acid from one end in adult hemoglobin is glutamic acid, whereas sickle-cell hemoglobin has valine at this position. After consulting the genetic code provided in Figure 15.10, indicate the type and location of the mutation that gave rise tosickle-cell anemia.arrow_forwardWhich is NOT a true difference between messenger RNA and DNA? (i.e., which of the following statements is false?) DNA remains in the nucleus (except when the nuclear envelope breaks down during mitosis), whereas mRNA is never in the nucleus; it is always in the cytoplasm. A DNA molecule has a longer life span than a typical molecule of RNA. DNA has thousands of genes; mRNA is usually a copy of just one gene. DNA has thousands of genes; mRNA is usually a copy of just one gene.arrow_forwardCan I have help with number 2 and 3? 2) 2What is the specific function of the enzyme catalase? 3) Catalase is an enzyme found in aerobic cells. What does this mean?arrow_forward
- A woman has an egg with a mutation for the gene that expresses whether the child can produce lactase enzymes. Here is the new nucleotide sequence with the change in bold. 3’ – ACCTCTTACTTCTATATATAGGGAAGACTAATTGTC – 5’ what type of mutation is this? Will this affect the child's abilty to produce lactase enzymes needed to digest lactose?arrow_forwardHurler syndrome is due to a mutation in a gene that encodes aprotein called α-l-iduronidase. This protein functions withinlysosomes as an enzyme that breaks down mucopolysaccharides(a type of polysaccharide that has many acidic groups attached).When this enzyme is defective, excessive amounts of the mucopolysaccharides dermatan sulfate and heparin sulfate accumulatewithin the lysosomes, especially in liver cells and connectivetissue cells. This accumulation leads to symptoms such as anenlarged liver and spleen, bone abnormalities, corneal clouding,heart problems, and severe neurological problems. The pedigreebelow contains three members affected with Hurler syndrome,indicated with black symbols. Based on this pedigree, does thissyndrome appear to follow autosomal recessive, autosomaldominant, X-linked recessive, or X-linked dominant inheritance?Explain your reasoning.arrow_forwardWhy do some genetic mutations lead to completely nonfunctional proteins while others do not affect the functioning of the resulting protein at all?arrow_forward
- Authophagy refers to naturally regulated mechanisms of degradation and removal of dysfunctional proteins. Denaturation is the unfolding of proteins under the effects of physical factors. Now, is denaturation part of the process of authophagy?arrow_forwardDetermine the effect of the following mutations on the DNA sequence. In each case, the mutation is described after the sequence (REFER TO THE SUPPLEMENTAL DOCUMENT FOR GUIDANCE TO THIS QUESTION). Guanine nucleotide (G shown in red below) was deleted from the DNA sequence at the position indicated by the arrow). Write out the sequence of the mutated DNA and the protein made from it. What is the effect of this mutation on the protein? (For example, how will the mutation affect the length and sequence of the protein? What about the function of the protein?) 3' TACATGGTTGTGCTAATT 5'arrow_forwardDetermine the effect of the following mutations on the DNA sequence. In each case, the mutation is described after the sequence (REFER TO THE SUPPLEMENTAL DOCUMENT FOR GUIDANCE TO THIS QUESTION). Guanine nucleotide (G shown in red below) was deleted from the DNA sequence at the position indicated by the arrow). Write out the sequence of the mutated DNA and the protein made from it. What is the effect of this mutation on the protein? (For example, how will the mutation affect the length and sequence of the protein? What about the function of the protein?)arrow_forward
arrow_back_ios
SEE MORE QUESTIONS
arrow_forward_ios
Recommended textbooks for you
- Human Anatomy & Physiology (11th Edition)BiologyISBN:9780134580999Author:Elaine N. Marieb, Katja N. HoehnPublisher:PEARSONBiology 2eBiologyISBN:9781947172517Author:Matthew Douglas, Jung Choi, Mary Ann ClarkPublisher:OpenStaxAnatomy & PhysiologyBiologyISBN:9781259398629Author:McKinley, Michael P., O'loughlin, Valerie Dean, Bidle, Theresa StouterPublisher:Mcgraw Hill Education,
- Molecular Biology of the Cell (Sixth Edition)BiologyISBN:9780815344322Author:Bruce Alberts, Alexander D. Johnson, Julian Lewis, David Morgan, Martin Raff, Keith Roberts, Peter WalterPublisher:W. W. Norton & CompanyLaboratory Manual For Human Anatomy & PhysiologyBiologyISBN:9781260159363Author:Martin, Terry R., Prentice-craver, CynthiaPublisher:McGraw-Hill Publishing Co.Inquiry Into Life (16th Edition)BiologyISBN:9781260231700Author:Sylvia S. Mader, Michael WindelspechtPublisher:McGraw Hill Education
Human Anatomy & Physiology (11th Edition)
Biology
ISBN:9780134580999
Author:Elaine N. Marieb, Katja N. Hoehn
Publisher:PEARSON
Biology 2e
Biology
ISBN:9781947172517
Author:Matthew Douglas, Jung Choi, Mary Ann Clark
Publisher:OpenStax
Anatomy & Physiology
Biology
ISBN:9781259398629
Author:McKinley, Michael P., O'loughlin, Valerie Dean, Bidle, Theresa Stouter
Publisher:Mcgraw Hill Education,
Molecular Biology of the Cell (Sixth Edition)
Biology
ISBN:9780815344322
Author:Bruce Alberts, Alexander D. Johnson, Julian Lewis, David Morgan, Martin Raff, Keith Roberts, Peter Walter
Publisher:W. W. Norton & Company
Laboratory Manual For Human Anatomy & Physiology
Biology
ISBN:9781260159363
Author:Martin, Terry R., Prentice-craver, Cynthia
Publisher:McGraw-Hill Publishing Co.
Inquiry Into Life (16th Edition)
Biology
ISBN:9781260231700
Author:Sylvia S. Mader, Michael Windelspecht
Publisher:McGraw Hill Education
What are Mutations and what are the different types of Mutations?; Author: Science ABC;https://www.youtube.com/watch?v=I16YlE8qTBU;License: Standard youtube license